FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625024_at:

>probe:Drosophila_2:1625024_at:719:613; Interrogation_Position=1625; Antisense; TGCACCTTAGAGCATCTCCTGATGA
>probe:Drosophila_2:1625024_at:508:445; Interrogation_Position=1648; Antisense; GATGCACATCCACTTAAATCTGGCA
>probe:Drosophila_2:1625024_at:2:199; Interrogation_Position=1682; Antisense; AACGATGTCTGTTCTGAATTGCTGA
>probe:Drosophila_2:1625024_at:513:363; Interrogation_Position=1697; Antisense; GAATTGCTGAAGAAACCGCCTAAAT
>probe:Drosophila_2:1625024_at:594:59; Interrogation_Position=1752; Antisense; ATGTTATGGACATTCGCCTGTCTGC
>probe:Drosophila_2:1625024_at:668:285; Interrogation_Position=1769; Antisense; CTGTCTGCCCACTATGTGAGGGATC
>probe:Drosophila_2:1625024_at:636:565; Interrogation_Position=1821; Antisense; GGCACATTACCATGCGTTCGCACAA
>probe:Drosophila_2:1625024_at:651:43; Interrogation_Position=1863; Antisense; AGACCACCTTCTATTTCAATTCGGA
>probe:Drosophila_2:1625024_at:224:389; Interrogation_Position=1886; Antisense; GAAAACATTTGTCCGCCGAACTTGG
>probe:Drosophila_2:1625024_at:334:383; Interrogation_Position=1903; Antisense; GAACTTGGCTCAGTGTTTCCAGTGT
>probe:Drosophila_2:1625024_at:286:553; Interrogation_Position=1948; Antisense; GGAGCGCACATATCATTCCTGGATA
>probe:Drosophila_2:1625024_at:23:545; Interrogation_Position=1968; Antisense; GGATATATCACAAGATTCGCTCACT
>probe:Drosophila_2:1625024_at:524:717; Interrogation_Position=1983; Antisense; TTCGCTCACTTAAGTAAGGCTTGCT
>probe:Drosophila_2:1625024_at:309:359; Interrogation_Position=2107; Antisense; GCAAGAATGTCCCTTAGCTGCATAA

Paste this into a BLAST search page for me
TGCACCTTAGAGCATCTCCTGATGAGATGCACATCCACTTAAATCTGGCAAACGATGTCTGTTCTGAATTGCTGAGAATTGCTGAAGAAACCGCCTAAATATGTTATGGACATTCGCCTGTCTGCCTGTCTGCCCACTATGTGAGGGATCGGCACATTACCATGCGTTCGCACAAAGACCACCTTCTATTTCAATTCGGAGAAAACATTTGTCCGCCGAACTTGGGAACTTGGCTCAGTGTTTCCAGTGTGGAGCGCACATATCATTCCTGGATAGGATATATCACAAGATTCGCTCACTTTCGCTCACTTAAGTAAGGCTTGCTGCAAGAATGTCCCTTAGCTGCATAA

Full Affymetrix probeset data:

Annotations for 1625024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720