FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625026_at:

>probe:Drosophila_2:1625026_at:370:387; Interrogation_Position=107; Antisense; GAACAAAATGCCTACCGCATCAGCA
>probe:Drosophila_2:1625026_at:326:35; Interrogation_Position=125; Antisense; ATCAGCACATCTGCCCATTCAGAAG
>probe:Drosophila_2:1625026_at:653:123; Interrogation_Position=148; Antisense; AGCGCCGGCCGCATGAGCACAATGG
>probe:Drosophila_2:1625026_at:107:125; Interrogation_Position=175; Antisense; AGCCCAGCTGCCAGGGTCTAGATGA
>probe:Drosophila_2:1625026_at:319:531; Interrogation_Position=200; Antisense; GGTGAACCGCATGTTCCGGAATTAC
>probe:Drosophila_2:1625026_at:56:559; Interrogation_Position=217; Antisense; GGAATTACTGGGATCCCACGGCCTA
>probe:Drosophila_2:1625026_at:268:421; Interrogation_Position=23; Antisense; GAGCAACAGGCTGCTAGCCGTTAAA
>probe:Drosophila_2:1625026_at:611:141; Interrogation_Position=234; Antisense; ACGGCCTACTGGGTGTGCGATAAGC
>probe:Drosophila_2:1625026_at:508:27; Interrogation_Position=253; Antisense; ATAAGCAGGGCACACGGGCTCGTCT
>probe:Drosophila_2:1625026_at:549:73; Interrogation_Position=310; Antisense; AGGAACTCGGCCGTTGCGTCCACTA
>probe:Drosophila_2:1625026_at:418:147; Interrogation_Position=331; Antisense; ACTATGCCGATTGGGCCTGGACGGA
>probe:Drosophila_2:1625026_at:12:333; Interrogation_Position=369; Antisense; GCTGGCCGAGCCAAGATCAGTCAAT
>probe:Drosophila_2:1625026_at:244:97; Interrogation_Position=382; Antisense; AGATCAGTCAATCGGTGTCCACAAA
>probe:Drosophila_2:1625026_at:697:125; Interrogation_Position=454; Antisense; ACCAACCTCATTAGGCTTACGTCTA

Paste this into a BLAST search page for me
GAACAAAATGCCTACCGCATCAGCAATCAGCACATCTGCCCATTCAGAAGAGCGCCGGCCGCATGAGCACAATGGAGCCCAGCTGCCAGGGTCTAGATGAGGTGAACCGCATGTTCCGGAATTACGGAATTACTGGGATCCCACGGCCTAGAGCAACAGGCTGCTAGCCGTTAAAACGGCCTACTGGGTGTGCGATAAGCATAAGCAGGGCACACGGGCTCGTCTAGGAACTCGGCCGTTGCGTCCACTAACTATGCCGATTGGGCCTGGACGGAGCTGGCCGAGCCAAGATCAGTCAATAGATCAGTCAATCGGTGTCCACAAAACCAACCTCATTAGGCTTACGTCTA

Full Affymetrix probeset data:

Annotations for 1625026_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720