Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625027_a_at:

>probe:Drosophila_2:1625027_a_at:621:715; Interrogation_Position=365; Antisense; TTCCTTGGGCCTGAGGATCAGCACA
>probe:Drosophila_2:1625027_a_at:355:545; Interrogation_Position=379; Antisense; GGATCAGCACAGACTATCTGCCGGC
>probe:Drosophila_2:1625027_a_at:546:551; Interrogation_Position=413; Antisense; GGAGACATGTTGCAATGACCACGAT
>probe:Drosophila_2:1625027_a_at:554:55; Interrogation_Position=427; Antisense; ATGACCACGATATCTGCTACGACAC
>probe:Drosophila_2:1625027_a_at:705:417; Interrogation_Position=468; Antisense; GAGCTGTGCGACCTGGACTTCAAGA
>probe:Drosophila_2:1625027_a_at:692:487; Interrogation_Position=506; Antisense; GTACTGCGACAGCTACGAGAAGTCC
>probe:Drosophila_2:1625027_a_at:191:423; Interrogation_Position=522; Antisense; GAGAAGTCCATAGCCAGCGATCTGA
>probe:Drosophila_2:1625027_a_at:629:97; Interrogation_Position=574; Antisense; AGATGCTATTCACCGGCACATTGAC
>probe:Drosophila_2:1625027_a_at:718:101; Interrogation_Position=658; Antisense; AGAGCTCCTCCTACAATGGCAATAG
>probe:Drosophila_2:1625027_a_at:182:243; Interrogation_Position=724; Antisense; AATATGGCTGGAAGGATCGCAACGA
>probe:Drosophila_2:1625027_a_at:576:487; Interrogation_Position=755; Antisense; GTACAGGATCACTGGCTACGAGGGT
>probe:Drosophila_2:1625027_a_at:161:729; Interrogation_Position=842; Antisense; TTGGGTAGCCATGTCCATTGGACTC
>probe:Drosophila_2:1625027_a_at:46:275; Interrogation_Position=857; Antisense; CATTGGACTCCCTTTTTGACGAATT
>probe:Drosophila_2:1625027_a_at:680:347; Interrogation_Position=905; Antisense; GCATGCCAACGGTCCAGACTGTTAA

Paste this into a BLAST search page for me
TTCCTTGGGCCTGAGGATCAGCACAGGATCAGCACAGACTATCTGCCGGCGGAGACATGTTGCAATGACCACGATATGACCACGATATCTGCTACGACACGAGCTGTGCGACCTGGACTTCAAGAGTACTGCGACAGCTACGAGAAGTCCGAGAAGTCCATAGCCAGCGATCTGAAGATGCTATTCACCGGCACATTGACAGAGCTCCTCCTACAATGGCAATAGAATATGGCTGGAAGGATCGCAACGAGTACAGGATCACTGGCTACGAGGGTTTGGGTAGCCATGTCCATTGGACTCCATTGGACTCCCTTTTTGACGAATTGCATGCCAACGGTCCAGACTGTTAA

Full Affymetrix probeset data:

Annotations for 1625027_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime