FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625031_at:

>probe:Drosophila_2:1625031_at:677:415; Interrogation_Position=1006; Antisense; GAGCCTGATCTTTGTCAATTCCTAG
>probe:Drosophila_2:1625031_at:208:9; Interrogation_Position=1023; Antisense; ATTCCTAGATAGTCAGTGCTTCCTT
>probe:Drosophila_2:1625031_at:228:275; Interrogation_Position=1041; Antisense; CTTCCTTCTGTGCATGTACGTTCGA
>probe:Drosophila_2:1625031_at:590:487; Interrogation_Position=1056; Antisense; GTACGTTCGACTGGACATGGGCAAA
>probe:Drosophila_2:1625031_at:618:425; Interrogation_Position=1118; Antisense; GAGAGACTTGCTTAGTTTTCGGCTA
>probe:Drosophila_2:1625031_at:583:259; Interrogation_Position=1186; Antisense; CACCGTGGTGGCAAATCTTGGCATA
>probe:Drosophila_2:1625031_at:141:647; Interrogation_Position=1201; Antisense; TCTTGGCATAGGTTCATCTCGCATA
>probe:Drosophila_2:1625031_at:147:163; Interrogation_Position=1244; Antisense; AAATTGAGAGTCGTCGCCGTTGGCC
>probe:Drosophila_2:1625031_at:260:503; Interrogation_Position=1256; Antisense; GTCGCCGTTGGCCAATGTAAATAAT
>probe:Drosophila_2:1625031_at:540:197; Interrogation_Position=1326; Antisense; AACGTGTCATCTGGATGGCTTGCCA
>probe:Drosophila_2:1625031_at:373:155; Interrogation_Position=862; Antisense; ACAGCCACTGTCTGGGTGGAGCCAC
>probe:Drosophila_2:1625031_at:319:403; Interrogation_Position=904; Antisense; GACTTCAAGCCCTTCGACCTGGAGT
>probe:Drosophila_2:1625031_at:672:555; Interrogation_Position=937; Antisense; GGACGTCGCCTCTTCCAGAACATAA
>probe:Drosophila_2:1625031_at:111:175; Interrogation_Position=965; Antisense; AAAGCCTGTAGGACCGATCGCATGG

Paste this into a BLAST search page for me
GAGCCTGATCTTTGTCAATTCCTAGATTCCTAGATAGTCAGTGCTTCCTTCTTCCTTCTGTGCATGTACGTTCGAGTACGTTCGACTGGACATGGGCAAAGAGAGACTTGCTTAGTTTTCGGCTACACCGTGGTGGCAAATCTTGGCATATCTTGGCATAGGTTCATCTCGCATAAAATTGAGAGTCGTCGCCGTTGGCCGTCGCCGTTGGCCAATGTAAATAATAACGTGTCATCTGGATGGCTTGCCAACAGCCACTGTCTGGGTGGAGCCACGACTTCAAGCCCTTCGACCTGGAGTGGACGTCGCCTCTTCCAGAACATAAAAAGCCTGTAGGACCGATCGCATGG

Full Affymetrix probeset data:

Annotations for 1625031_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720