Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625032_s_at:

>probe:Drosophila_2:1625032_s_at:137:317; Interrogation_Position=396; Antisense; GCCGACTCAGCGACGATTTTACAGC
>probe:Drosophila_2:1625032_s_at:647:325; Interrogation_Position=435; Antisense; GCGAGAAATGCGACCGGCTGAACAA
>probe:Drosophila_2:1625032_s_at:426:219; Interrogation_Position=473; Antisense; AAGTCGGATGAATACGCGCCTCAGC
>probe:Drosophila_2:1625032_s_at:155:465; Interrogation_Position=505; Antisense; GATTGCAGCTTCCAATGCCGATGGC
>probe:Drosophila_2:1625032_s_at:631:67; Interrogation_Position=525; Antisense; ATGGCGACTGCGATCGTCACGTGGA
>probe:Drosophila_2:1625032_s_at:419:259; Interrogation_Position=542; Antisense; CACGTGGAGCACTTCCTGAACGGAA
>probe:Drosophila_2:1625032_s_at:682:209; Interrogation_Position=566; Antisense; AAGACCGACGTGCAGACTTTCCTCA
>probe:Drosophila_2:1625032_s_at:514:77; Interrogation_Position=581; Antisense; ACTTTCCTCAACACGTACCAGTGGT
>probe:Drosophila_2:1625032_s_at:107:95; Interrogation_Position=612; Antisense; AGATCAGTACCGAGCGCAAGGCCAA
>probe:Drosophila_2:1625032_s_at:385:539; Interrogation_Position=680; Antisense; GGTATCTAGGATTGCCGTGACACTC
>probe:Drosophila_2:1625032_s_at:48:371; Interrogation_Position=898; Antisense; GAAGGTGCACTAGTTGTTCGTTTCC
>probe:Drosophila_2:1625032_s_at:344:603; Interrogation_Position=912; Antisense; TGTTCGTTTCCCAAGATCGTTTACT
>probe:Drosophila_2:1625032_s_at:201:435; Interrogation_Position=943; Antisense; GAGGGTCTTGTTATTCTATCCGTAC
>probe:Drosophila_2:1625032_s_at:535:485; Interrogation_Position=964; Antisense; GTACCCCGAAACGAAGCACTATGTG

Paste this into a BLAST search page for me
GCCGACTCAGCGACGATTTTACAGCGCGAGAAATGCGACCGGCTGAACAAAAGTCGGATGAATACGCGCCTCAGCGATTGCAGCTTCCAATGCCGATGGCATGGCGACTGCGATCGTCACGTGGACACGTGGAGCACTTCCTGAACGGAAAAGACCGACGTGCAGACTTTCCTCAACTTTCCTCAACACGTACCAGTGGTAGATCAGTACCGAGCGCAAGGCCAAGGTATCTAGGATTGCCGTGACACTCGAAGGTGCACTAGTTGTTCGTTTCCTGTTCGTTTCCCAAGATCGTTTACTGAGGGTCTTGTTATTCTATCCGTACGTACCCCGAAACGAAGCACTATGTG

Full Affymetrix probeset data:

Annotations for 1625032_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime