Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625033_at:

>probe:Drosophila_2:1625033_at:208:453; Interrogation_Position=4134; Antisense; GATCTTGGAGCGAGAACAGCACCTT
>probe:Drosophila_2:1625033_at:504:713; Interrogation_Position=4157; Antisense; TTCTACATCATAGCGCGCCACAAGG
>probe:Drosophila_2:1625033_at:162:85; Interrogation_Position=4195; Antisense; AGTGTGTCTGACATATCGACCCACG
>probe:Drosophila_2:1625033_at:314:727; Interrogation_Position=4238; Antisense; TTGGTAGTGGGCGATGCCTGCTATC
>probe:Drosophila_2:1625033_at:52:205; Interrogation_Position=4274; Antisense; AAGCCGCCCGATCACCATTTGGAGG
>probe:Drosophila_2:1625033_at:107:675; Interrogation_Position=4291; Antisense; TTTGGAGGCCAACCTATCAGTTTTG
>probe:Drosophila_2:1625033_at:291:217; Interrogation_Position=4350; Antisense; AAGTTCACCTGGTCAACTGGCTGCT
>probe:Drosophila_2:1625033_at:180:335; Interrogation_Position=4408; Antisense; GCTGCACAGCTGAGGGACAACAAGT
>probe:Drosophila_2:1625033_at:508:217; Interrogation_Position=4445; Antisense; AAGTAGACACATGTGGGCACCACCT
>probe:Drosophila_2:1625033_at:511:329; Interrogation_Position=4472; Antisense; GCGTGACAAGCCAAAGCGCTACGTA
>probe:Drosophila_2:1625033_at:366:483; Interrogation_Position=4494; Antisense; GTATACATCACTAATTCCCCGAAAC
>probe:Drosophila_2:1625033_at:215:633; Interrogation_Position=4509; Antisense; TCCCCGAAACCAAATCCCATTATGA
>probe:Drosophila_2:1625033_at:690:393; Interrogation_Position=4598; Antisense; GAAATCGAACCACTTCGCGCTGGTT
>probe:Drosophila_2:1625033_at:378:719; Interrogation_Position=4611; Antisense; TTCGCGCTGGTTTGGCTGTATATAA

Paste this into a BLAST search page for me
GATCTTGGAGCGAGAACAGCACCTTTTCTACATCATAGCGCGCCACAAGGAGTGTGTCTGACATATCGACCCACGTTGGTAGTGGGCGATGCCTGCTATCAAGCCGCCCGATCACCATTTGGAGGTTTGGAGGCCAACCTATCAGTTTTGAAGTTCACCTGGTCAACTGGCTGCTGCTGCACAGCTGAGGGACAACAAGTAAGTAGACACATGTGGGCACCACCTGCGTGACAAGCCAAAGCGCTACGTAGTATACATCACTAATTCCCCGAAACTCCCCGAAACCAAATCCCATTATGAGAAATCGAACCACTTCGCGCTGGTTTTCGCGCTGGTTTGGCTGTATATAA

Full Affymetrix probeset data:

Annotations for 1625033_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime