FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625036_at:

>probe:Drosophila_2:1625036_at:711:307; Interrogation_Position=1103; Antisense; CCAATCTCCTTCTCGGTTATATTAT
>probe:Drosophila_2:1625036_at:230:251; Interrogation_Position=1143; Antisense; CAAGTGGTCGATCCGACTGGGATTA
>probe:Drosophila_2:1625036_at:514:529; Interrogation_Position=1161; Antisense; GGGATTATTACTCCTGCTATTGCAG
>probe:Drosophila_2:1625036_at:608:341; Interrogation_Position=1176; Antisense; GCTATTGCAGTTGTTCTTCTTCGGC
>probe:Drosophila_2:1625036_at:692:343; Interrogation_Position=1182; Antisense; GCAGTTGTTCTTCTTCGGCTTTGGA
>probe:Drosophila_2:1625036_at:51:91; Interrogation_Position=1422; Antisense; AGTTAATTCACCAATTTCAATGCCC
>probe:Drosophila_2:1625036_at:70:221; Interrogation_Position=1455; Antisense; AAGTGCCATTGGTGTATTTGTAGCC
>probe:Drosophila_2:1625036_at:25:481; Interrogation_Position=1468; Antisense; GTATTTGTAGCCATCGTCTTGACAG
>probe:Drosophila_2:1625036_at:360:315; Interrogation_Position=1477; Antisense; GCCATCGTCTTGACAGGTTTTATTA
>probe:Drosophila_2:1625036_at:616:73; Interrogation_Position=1505; Antisense; AGGAGACTGTCGAAAAGGCACCATT
>probe:Drosophila_2:1625036_at:248:387; Interrogation_Position=1516; Antisense; GAAAAGGCACCATTGATCTATAAGA
>probe:Drosophila_2:1625036_at:281:215; Interrogation_Position=1537; Antisense; AAGATCATAGACGACGCTAGCGAGG
>probe:Drosophila_2:1625036_at:109:279; Interrogation_Position=1553; Antisense; CTAGCGAGGATGAGGTAGAACCACT
>probe:Drosophila_2:1625036_at:508:99; Interrogation_Position=1569; Antisense; AGAACCACTAGCGAAAACAACATTT

Paste this into a BLAST search page for me
CCAATCTCCTTCTCGGTTATATTATCAAGTGGTCGATCCGACTGGGATTAGGGATTATTACTCCTGCTATTGCAGGCTATTGCAGTTGTTCTTCTTCGGCGCAGTTGTTCTTCTTCGGCTTTGGAAGTTAATTCACCAATTTCAATGCCCAAGTGCCATTGGTGTATTTGTAGCCGTATTTGTAGCCATCGTCTTGACAGGCCATCGTCTTGACAGGTTTTATTAAGGAGACTGTCGAAAAGGCACCATTGAAAAGGCACCATTGATCTATAAGAAAGATCATAGACGACGCTAGCGAGGCTAGCGAGGATGAGGTAGAACCACTAGAACCACTAGCGAAAACAACATTT

Full Affymetrix probeset data:

Annotations for 1625036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720