Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625039_at:

>probe:Drosophila_2:1625039_at:181:519; Interrogation_Position=4110; Antisense; GTGGGATCAATTACGCTACCTGCAT
>probe:Drosophila_2:1625039_at:522:339; Interrogation_Position=4124; Antisense; GCTACCTGCATCTAAAAGTCCTTAC
>probe:Drosophila_2:1625039_at:20:267; Interrogation_Position=4190; Antisense; CAGATTTTATGACAGCCTACGGCAG
>probe:Drosophila_2:1625039_at:272:21; Interrogation_Position=4216; Antisense; ATATTTCAGCTCACGAACTCGACGG
>probe:Drosophila_2:1625039_at:133:283; Interrogation_Position=4317; Antisense; GCTGTCCCAAGTGAGGCTACGGCGA
>probe:Drosophila_2:1625039_at:628:687; Interrogation_Position=4346; Antisense; TATTCCGACGATCCTACGACATGGT
>probe:Drosophila_2:1625039_at:542:533; Interrogation_Position=4368; Antisense; GGTGCTCCAGCCTTTTCAAGTTATG
>probe:Drosophila_2:1625039_at:195:653; Interrogation_Position=4383; Antisense; TCAAGTTATGTCTTTGCCGCTGCCA
>probe:Drosophila_2:1625039_at:349:659; Interrogation_Position=4451; Antisense; TAACTCGCGAGACCGGACTGTACTA
>probe:Drosophila_2:1625039_at:350:401; Interrogation_Position=4466; Antisense; GACTGTACTATTACTGGTTCCGGCG
>probe:Drosophila_2:1625039_at:427:521; Interrogation_Position=4507; Antisense; GTGGCTCTCGGGAAGATCTCGTACA
>probe:Drosophila_2:1625039_at:456:133; Interrogation_Position=4547; Antisense; ACCCGTACTGCGATCTCAAGTGGAA
>probe:Drosophila_2:1625039_at:682:147; Interrogation_Position=4609; Antisense; ACTATCATTAGTTGTCTGGCGCTCC
>probe:Drosophila_2:1625039_at:69:539; Interrogation_Position=4641; Antisense; GGTAGCTCACTACAGGTGGCACTTG

Paste this into a BLAST search page for me
GTGGGATCAATTACGCTACCTGCATGCTACCTGCATCTAAAAGTCCTTACCAGATTTTATGACAGCCTACGGCAGATATTTCAGCTCACGAACTCGACGGGCTGTCCCAAGTGAGGCTACGGCGATATTCCGACGATCCTACGACATGGTGGTGCTCCAGCCTTTTCAAGTTATGTCAAGTTATGTCTTTGCCGCTGCCATAACTCGCGAGACCGGACTGTACTAGACTGTACTATTACTGGTTCCGGCGGTGGCTCTCGGGAAGATCTCGTACAACCCGTACTGCGATCTCAAGTGGAAACTATCATTAGTTGTCTGGCGCTCCGGTAGCTCACTACAGGTGGCACTTG

Full Affymetrix probeset data:

Annotations for 1625039_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime