Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625041_at:

>probe:Drosophila_2:1625041_at:98:641; Interrogation_Position=3108; Antisense; TCGGCGACGAGCCTTGCACAAGCTG
>probe:Drosophila_2:1625041_at:561:357; Interrogation_Position=3123; Antisense; GCACAAGCTGCAGGATTTCCAATAA
>probe:Drosophila_2:1625041_at:140:37; Interrogation_Position=3174; Antisense; ATCATTTGTCTAGTTTGTTAGCCTA
>probe:Drosophila_2:1625041_at:387:473; Interrogation_Position=3190; Antisense; GTTAGCCTAGTGCAAGAGTTATGTA
>probe:Drosophila_2:1625041_at:466:709; Interrogation_Position=3220; Antisense; TTAAGTGGCATCTTCGAGCGTCGGG
>probe:Drosophila_2:1625041_at:622:417; Interrogation_Position=3235; Antisense; GAGCGTCGGGAGACCTCATTCAAAT
>probe:Drosophila_2:1625041_at:402:163; Interrogation_Position=3256; Antisense; AAATCCACATTAGAACGCGCTCGTC
>probe:Drosophila_2:1625041_at:698:45; Interrogation_Position=3308; Antisense; ATCCCAGCACCATATTCTACATGAA
>probe:Drosophila_2:1625041_at:102:379; Interrogation_Position=3330; Antisense; GAAGCCCATGGATTGCGATTTGAAT
>probe:Drosophila_2:1625041_at:702:367; Interrogation_Position=3351; Antisense; GAATCCTTGTAAATCTCAACGCGAA
>probe:Drosophila_2:1625041_at:143:403; Interrogation_Position=3395; Antisense; GACATTATCTAACGTCATGCATGAG
>probe:Drosophila_2:1625041_at:461:609; Interrogation_Position=3416; Antisense; TGAGCGTAGTTAATCGACGAGCTAA
>probe:Drosophila_2:1625041_at:699:409; Interrogation_Position=3431; Antisense; GACGAGCTAATACTACAAACTGATC
>probe:Drosophila_2:1625041_at:217:485; Interrogation_Position=3573; Antisense; GTATGTAATTGCAACCTATCTGTGG

Paste this into a BLAST search page for me
TCGGCGACGAGCCTTGCACAAGCTGGCACAAGCTGCAGGATTTCCAATAAATCATTTGTCTAGTTTGTTAGCCTAGTTAGCCTAGTGCAAGAGTTATGTATTAAGTGGCATCTTCGAGCGTCGGGGAGCGTCGGGAGACCTCATTCAAATAAATCCACATTAGAACGCGCTCGTCATCCCAGCACCATATTCTACATGAAGAAGCCCATGGATTGCGATTTGAATGAATCCTTGTAAATCTCAACGCGAAGACATTATCTAACGTCATGCATGAGTGAGCGTAGTTAATCGACGAGCTAAGACGAGCTAATACTACAAACTGATCGTATGTAATTGCAACCTATCTGTGG

Full Affymetrix probeset data:

Annotations for 1625041_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime