Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625042_at:

>probe:Drosophila_2:1625042_at:100:615; Interrogation_Position=1016; Antisense; TGAAGCTGAAAAAGCCCCTGCCAAA
>probe:Drosophila_2:1625042_at:408:305; Interrogation_Position=1032; Antisense; CCTGCCAAAACTTCGTGATCTTCAA
>probe:Drosophila_2:1625042_at:395:211; Interrogation_Position=1072; Antisense; AAGAACCACTCCTTTTATGCTTTCT
>probe:Drosophila_2:1625042_at:729:681; Interrogation_Position=1087; Antisense; TATGCTTTCTTCAGCATCCTGAACC
>probe:Drosophila_2:1625042_at:204:359; Interrogation_Position=1148; Antisense; GCAACATACACAACTTATCCGCTAA
>probe:Drosophila_2:1625042_at:37:661; Interrogation_Position=1194; Antisense; TAGACTACGTTTGCTCTCAAATCCC
>probe:Drosophila_2:1625042_at:616:595; Interrogation_Position=1244; Antisense; TGTACCCCTTCTTGTATAACCGTGG
>probe:Drosophila_2:1625042_at:717:11; Interrogation_Position=709; Antisense; ATTAAGGCATTTCCCACTGTTAAGC
>probe:Drosophila_2:1625042_at:420:3; Interrogation_Position=737; Antisense; ATTGGGCGCAATGTCTTAGTACTTT
>probe:Drosophila_2:1625042_at:279:361; Interrogation_Position=778; Antisense; GAATTTCATGTGCTTAACCACGGCG
>probe:Drosophila_2:1625042_at:421:201; Interrogation_Position=793; Antisense; AACCACGGCGACTTTTGGTCGAGCA
>probe:Drosophila_2:1625042_at:396:39; Interrogation_Position=833; Antisense; ATCTGCCGGACGGAACTCTCGAGAA
>probe:Drosophila_2:1625042_at:71:723; Interrogation_Position=946; Antisense; TTGCGCATCAAGGAGTTCGACCATT
>probe:Drosophila_2:1625042_at:341:141; Interrogation_Position=983; Antisense; ACTGGGAACGTCTGGTCGAGTGCTT

Paste this into a BLAST search page for me
TGAAGCTGAAAAAGCCCCTGCCAAACCTGCCAAAACTTCGTGATCTTCAAAAGAACCACTCCTTTTATGCTTTCTTATGCTTTCTTCAGCATCCTGAACCGCAACATACACAACTTATCCGCTAATAGACTACGTTTGCTCTCAAATCCCTGTACCCCTTCTTGTATAACCGTGGATTAAGGCATTTCCCACTGTTAAGCATTGGGCGCAATGTCTTAGTACTTTGAATTTCATGTGCTTAACCACGGCGAACCACGGCGACTTTTGGTCGAGCAATCTGCCGGACGGAACTCTCGAGAATTGCGCATCAAGGAGTTCGACCATTACTGGGAACGTCTGGTCGAGTGCTT

Full Affymetrix probeset data:

Annotations for 1625042_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime