FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625044_at:

>probe:Drosophila_2:1625044_at:229:237; Interrogation_Position=109; Antisense; AATCTGTACCGTCATGTCGAAACCA
>probe:Drosophila_2:1625044_at:637:373; Interrogation_Position=167; Antisense; GAAGAGTTGGTTGCCATCCTGGGAC
>probe:Drosophila_2:1625044_at:439:633; Interrogation_Position=198; Antisense; TCCCGCGCACCATTGTGTCAAAGAA
>probe:Drosophila_2:1625044_at:647:451; Interrogation_Position=227; Antisense; GATCTTCCGGAATTGCAAGGCGACA
>probe:Drosophila_2:1625044_at:663:677; Interrogation_Position=325; Antisense; TAGTCTGTGCTTCAATGCGCTGGAG
>probe:Drosophila_2:1625044_at:377:531; Interrogation_Position=358; Antisense; GGGTCCGTACATCAAATGGTTCCTG
>probe:Drosophila_2:1625044_at:319:665; Interrogation_Position=405; Antisense; TACACCGTCTGCTCCATGGTTGGGA
>probe:Drosophila_2:1625044_at:529:173; Interrogation_Position=435; Antisense; AAAGCGCTCAGGCTATTTGCACCTT
>probe:Drosophila_2:1625044_at:658:687; Interrogation_Position=448; Antisense; TATTTGCACCTTTGGCTACTGCGAC
>probe:Drosophila_2:1625044_at:189:547; Interrogation_Position=478; Antisense; GGATGCCGAGCCTCTAATCTTTAAG
>probe:Drosophila_2:1625044_at:401:659; Interrogation_Position=497; Antisense; TTTAAGGGCATCACCGAGGGCGTTA
>probe:Drosophila_2:1625044_at:360:669; Interrogation_Position=581; Antisense; TACGATAAGACCTACGCCGAACTGC
>probe:Drosophila_2:1625044_at:143:503; Interrogation_Position=610; Antisense; GTCCGAGAAGAACACCATTTCCCAT
>probe:Drosophila_2:1625044_at:68:645; Interrogation_Position=652; Antisense; TCTACTGCGGCAGCACTTCGAGAAA

Paste this into a BLAST search page for me
AATCTGTACCGTCATGTCGAAACCAGAAGAGTTGGTTGCCATCCTGGGACTCCCGCGCACCATTGTGTCAAAGAAGATCTTCCGGAATTGCAAGGCGACATAGTCTGTGCTTCAATGCGCTGGAGGGGTCCGTACATCAAATGGTTCCTGTACACCGTCTGCTCCATGGTTGGGAAAAGCGCTCAGGCTATTTGCACCTTTATTTGCACCTTTGGCTACTGCGACGGATGCCGAGCCTCTAATCTTTAAGTTTAAGGGCATCACCGAGGGCGTTATACGATAAGACCTACGCCGAACTGCGTCCGAGAAGAACACCATTTCCCATTCTACTGCGGCAGCACTTCGAGAAA

Full Affymetrix probeset data:

Annotations for 1625044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720