FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625046_at:

>probe:Drosophila_2:1625046_at:88:189; Interrogation_Position=1032; Antisense; AACAGTCGACGCAGCCGCTCGAAGC
>probe:Drosophila_2:1625046_at:661:337; Interrogation_Position=1048; Antisense; GCTCGAAGCCCAAACTGCAGCTGGA
>probe:Drosophila_2:1625046_at:244:73; Interrogation_Position=1096; Antisense; AGGCACAGCGGCAGATGCGCCATTA
>probe:Drosophila_2:1625046_at:273:625; Interrogation_Position=1111; Antisense; TGCGCCATTAGCCAGGTCCACAATA
>probe:Drosophila_2:1625046_at:430:79; Interrogation_Position=1124; Antisense; AGGTCCACAATATATATTTCTCCCC
>probe:Drosophila_2:1625046_at:404:307; Interrogation_Position=1154; Antisense; CCATGCTCAATCCACTTAGCTGTTA
>probe:Drosophila_2:1625046_at:617:595; Interrogation_Position=1174; Antisense; TGTTAACGCTTATTGTTTAGCCGGT
>probe:Drosophila_2:1625046_at:320:587; Interrogation_Position=742; Antisense; TGGACGGCGACGATTCACGCGAAGC
>probe:Drosophila_2:1625046_at:449:7; Interrogation_Position=754; Antisense; ATTCACGCGAAGCTGAGGAAGTACA
>probe:Drosophila_2:1625046_at:622:563; Interrogation_Position=770; Antisense; GGAAGTACAGAGATCCCTGCTCGAC
>probe:Drosophila_2:1625046_at:99:365; Interrogation_Position=800; Antisense; GTTCGTCGAGGCAGATACGGACGAT
>probe:Drosophila_2:1625046_at:578:407; Interrogation_Position=864; Antisense; GACGACTACGACAGCGATTCCGGCA
>probe:Drosophila_2:1625046_at:716:725; Interrogation_Position=961; Antisense; TTGAGGAGACCAAAGTGCCAGCCAA
>probe:Drosophila_2:1625046_at:542:313; Interrogation_Position=977; Antisense; GCCAGCCAAGAAAACCGCCAGCAAA

Paste this into a BLAST search page for me
AACAGTCGACGCAGCCGCTCGAAGCGCTCGAAGCCCAAACTGCAGCTGGAAGGCACAGCGGCAGATGCGCCATTATGCGCCATTAGCCAGGTCCACAATAAGGTCCACAATATATATTTCTCCCCCCATGCTCAATCCACTTAGCTGTTATGTTAACGCTTATTGTTTAGCCGGTTGGACGGCGACGATTCACGCGAAGCATTCACGCGAAGCTGAGGAAGTACAGGAAGTACAGAGATCCCTGCTCGACGTTCGTCGAGGCAGATACGGACGATGACGACTACGACAGCGATTCCGGCATTGAGGAGACCAAAGTGCCAGCCAAGCCAGCCAAGAAAACCGCCAGCAAA

Full Affymetrix probeset data:

Annotations for 1625046_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720