FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625047_at:

>probe:Drosophila_2:1625047_at:367:329; Interrogation_Position=2070; Antisense; GCGTGCGAAGATTTCATCACTTTGT
>probe:Drosophila_2:1625047_at:532:21; Interrogation_Position=2114; Antisense; ATATATCTCCTTATGCTTACTATCA
>probe:Drosophila_2:1625047_at:237:343; Interrogation_Position=2128; Antisense; GCTTACTATCATACGTATCCTTCTC
>probe:Drosophila_2:1625047_at:222:485; Interrogation_Position=2142; Antisense; GTATCCTTCTCGCAGTCGCTTTAAC
>probe:Drosophila_2:1625047_at:243:503; Interrogation_Position=2156; Antisense; GTCGCTTTAACTCTATTGCTTTTCC
>probe:Drosophila_2:1625047_at:432:7; Interrogation_Position=2170; Antisense; ATTGCTTTTCCAACTCTGCGTTTAA
>probe:Drosophila_2:1625047_at:498:281; Interrogation_Position=2183; Antisense; CTCTGCGTTTAAGTTTATCCCATTT
>probe:Drosophila_2:1625047_at:384:701; Interrogation_Position=2262; Antisense; TTTTATTTGTTACGTCGCCAGGACA
>probe:Drosophila_2:1625047_at:241:173; Interrogation_Position=2290; Antisense; AAAGCAACTGCAAACGATCATGAAT
>probe:Drosophila_2:1625047_at:509:509; Interrogation_Position=2361; Antisense; GTGCATATGCAACACCACACGATCA
>probe:Drosophila_2:1625047_at:228:133; Interrogation_Position=2387; Antisense; ACGCGCGTACGCATATTCAAAACAT
>probe:Drosophila_2:1625047_at:403:35; Interrogation_Position=2410; Antisense; ATCAGCATATTCACCTAAAGCCGTA
>probe:Drosophila_2:1625047_at:249:75; Interrogation_Position=2494; Antisense; AGGAGACCGATTTCGCCTACGATAA
>probe:Drosophila_2:1625047_at:583:557; Interrogation_Position=2531; Antisense; GGACATAGCAAACCACATACGATCA

Paste this into a BLAST search page for me
GCGTGCGAAGATTTCATCACTTTGTATATATCTCCTTATGCTTACTATCAGCTTACTATCATACGTATCCTTCTCGTATCCTTCTCGCAGTCGCTTTAACGTCGCTTTAACTCTATTGCTTTTCCATTGCTTTTCCAACTCTGCGTTTAACTCTGCGTTTAAGTTTATCCCATTTTTTTATTTGTTACGTCGCCAGGACAAAAGCAACTGCAAACGATCATGAATGTGCATATGCAACACCACACGATCAACGCGCGTACGCATATTCAAAACATATCAGCATATTCACCTAAAGCCGTAAGGAGACCGATTTCGCCTACGATAAGGACATAGCAAACCACATACGATCA

Full Affymetrix probeset data:

Annotations for 1625047_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720