Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625048_at:

>probe:Drosophila_2:1625048_at:536:699; Interrogation_Position=9202; Antisense; TTTTAAACCAAGTTCACCTCTCTCA
>probe:Drosophila_2:1625048_at:545:649; Interrogation_Position=9215; Antisense; TCACCTCTCTCATTAGTCCTTACTA
>probe:Drosophila_2:1625048_at:662:701; Interrogation_Position=9242; Antisense; TTATTTCATCAGCACATTTTCCAAG
>probe:Drosophila_2:1625048_at:182:655; Interrogation_Position=9299; Antisense; TAAGCTTAAAACGACCCAGTCCGCT
>probe:Drosophila_2:1625048_at:89:411; Interrogation_Position=9311; Antisense; GACCCAGTCCGCTTTAAATATAATT
>probe:Drosophila_2:1625048_at:137:381; Interrogation_Position=9413; Antisense; GAACGTTACACATTTGTACCTCTTA
>probe:Drosophila_2:1625048_at:403:377; Interrogation_Position=9451; Antisense; GAAGCAAATTAGTCCGTTACACTTA
>probe:Drosophila_2:1625048_at:415:475; Interrogation_Position=9466; Antisense; GTTACACTTACTTTCTAGCACATGG
>probe:Drosophila_2:1625048_at:430:663; Interrogation_Position=9495; Antisense; TAAACTGTATTTGGCGTTATCCGCA
>probe:Drosophila_2:1625048_at:375:573; Interrogation_Position=9507; Antisense; GGCGTTATCCGCATTAAACAAGAAC
>probe:Drosophila_2:1625048_at:612:561; Interrogation_Position=9559; Antisense; GGAACTGGATTCTATACATTATTAT
>probe:Drosophila_2:1625048_at:626:63; Interrogation_Position=9598; Antisense; ATGTGTGTGTTGCTATATGTGTATT
>probe:Drosophila_2:1625048_at:491:491; Interrogation_Position=9641; Antisense; GTAAATTACAGCCACTTGAAGATAT
>probe:Drosophila_2:1625048_at:192:475; Interrogation_Position=9675; Antisense; GTTAATGTCCCAAATTTATCAATGT

Paste this into a BLAST search page for me
TTTTAAACCAAGTTCACCTCTCTCATCACCTCTCTCATTAGTCCTTACTATTATTTCATCAGCACATTTTCCAAGTAAGCTTAAAACGACCCAGTCCGCTGACCCAGTCCGCTTTAAATATAATTGAACGTTACACATTTGTACCTCTTAGAAGCAAATTAGTCCGTTACACTTAGTTACACTTACTTTCTAGCACATGGTAAACTGTATTTGGCGTTATCCGCAGGCGTTATCCGCATTAAACAAGAACGGAACTGGATTCTATACATTATTATATGTGTGTGTTGCTATATGTGTATTGTAAATTACAGCCACTTGAAGATATGTTAATGTCCCAAATTTATCAATGT

Full Affymetrix probeset data:

Annotations for 1625048_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime