FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625049_at:

>probe:Drosophila_2:1625049_at:696:107; Interrogation_Position=446; Antisense; AGAACCTCCGTGTGGTTTTCATCAG
>probe:Drosophila_2:1625049_at:138:81; Interrogation_Position=563; Antisense; AGGGTGATCTGTCCAGCCTGGCCAA
>probe:Drosophila_2:1625049_at:460:263; Interrogation_Position=595; Antisense; CAGAACCTGAACCATGTGAGCGCCA
>probe:Drosophila_2:1625049_at:449:111; Interrogation_Position=619; Antisense; AGCAAGCCGGAGGTGCATTTCGTCA
>probe:Drosophila_2:1625049_at:156:301; Interrogation_Position=674; Antisense; CCCAGCGTACCATTCAGCAGGAGTA
>probe:Drosophila_2:1625049_at:271:665; Interrogation_Position=727; Antisense; TACAACGGAGGCGTGGCACCAGTCC
>probe:Drosophila_2:1625049_at:96:87; Interrogation_Position=747; Antisense; AGTCCTGGACTTTGCCACCAAAGTG
>probe:Drosophila_2:1625049_at:103:605; Interrogation_Position=821; Antisense; TGATTGATGAGCGTCGGCCTTCCAG
>probe:Drosophila_2:1625049_at:58:493; Interrogation_Position=853; Antisense; GTAAGCGCCGAACTGGAGGCTCCTT
>probe:Drosophila_2:1625049_at:283:641; Interrogation_Position=877; Antisense; TCGGCAGGATATATTCCACCACCAG
>probe:Drosophila_2:1625049_at:647:627; Interrogation_Position=915; Antisense; TGCCACGTACCTGCCTGTGAACAAG
>probe:Drosophila_2:1625049_at:655:557; Interrogation_Position=948; Antisense; GGAAACCTGCAAGACCACATTCTTA
>probe:Drosophila_2:1625049_at:144:245; Interrogation_Position=979; Antisense; AATTAGCTCACACATTCTCCTTTAA
>probe:Drosophila_2:1625049_at:526:697; Interrogation_Position=993; Antisense; TTCTCCTTTAAGTGCTACCGTATAA

Paste this into a BLAST search page for me
AGAACCTCCGTGTGGTTTTCATCAGAGGGTGATCTGTCCAGCCTGGCCAACAGAACCTGAACCATGTGAGCGCCAAGCAAGCCGGAGGTGCATTTCGTCACCCAGCGTACCATTCAGCAGGAGTATACAACGGAGGCGTGGCACCAGTCCAGTCCTGGACTTTGCCACCAAAGTGTGATTGATGAGCGTCGGCCTTCCAGGTAAGCGCCGAACTGGAGGCTCCTTTCGGCAGGATATATTCCACCACCAGTGCCACGTACCTGCCTGTGAACAAGGGAAACCTGCAAGACCACATTCTTAAATTAGCTCACACATTCTCCTTTAATTCTCCTTTAAGTGCTACCGTATAA

Full Affymetrix probeset data:

Annotations for 1625049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720