Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625051_at:

>probe:Drosophila_2:1625051_at:451:483; Interrogation_Position=1008; Antisense; GTATCCGTGATACGTTACGCAGGAT
>probe:Drosophila_2:1625051_at:95:243; Interrogation_Position=1037; Antisense; AATATACCTCTAACAACGGCATTGG
>probe:Drosophila_2:1625051_at:423:25; Interrogation_Position=545; Antisense; ATAGATGTGGACAACCTGCCACCAC
>probe:Drosophila_2:1625051_at:416:107; Interrogation_Position=588; Antisense; AGAACCGGCTGCAGCACACATACTG
>probe:Drosophila_2:1625051_at:496:627; Interrogation_Position=611; Antisense; TGCCTCTGGTTCTCTCGCAAGGAGA
>probe:Drosophila_2:1625051_at:273:217; Interrogation_Position=662; Antisense; AAGTCGCTGCACATGGTCGGCCGGT
>probe:Drosophila_2:1625051_at:629:509; Interrogation_Position=695; Antisense; GTGCAGCAGTGGTGGTCGCTCTACT
>probe:Drosophila_2:1625051_at:614:269; Interrogation_Position=781; Antisense; CATCATACCGATGTGGGAGGACCCG
>probe:Drosophila_2:1625051_at:653:563; Interrogation_Position=818; Antisense; GGCGGCCAGTGGTTGATACGACTAC
>probe:Drosophila_2:1625051_at:270:107; Interrogation_Position=870; Antisense; AGAACGTTTGTATGGCGATGCTCGG
>probe:Drosophila_2:1625051_at:546:427; Interrogation_Position=917; Antisense; GAGATATGCGGAGTCGTGCTACAGA
>probe:Drosophila_2:1625051_at:387:27; Interrogation_Position=957; Antisense; ATAGCTTATCAGTATGGCACCGGAC
>probe:Drosophila_2:1625051_at:431:129; Interrogation_Position=975; Antisense; ACCGGACTGCCACTGATATGACCAG
>probe:Drosophila_2:1625051_at:494:55; Interrogation_Position=992; Antisense; ATGACCAGTACAACACGTATCCGTG

Paste this into a BLAST search page for me
GTATCCGTGATACGTTACGCAGGATAATATACCTCTAACAACGGCATTGGATAGATGTGGACAACCTGCCACCACAGAACCGGCTGCAGCACACATACTGTGCCTCTGGTTCTCTCGCAAGGAGAAAGTCGCTGCACATGGTCGGCCGGTGTGCAGCAGTGGTGGTCGCTCTACTCATCATACCGATGTGGGAGGACCCGGGCGGCCAGTGGTTGATACGACTACAGAACGTTTGTATGGCGATGCTCGGGAGATATGCGGAGTCGTGCTACAGAATAGCTTATCAGTATGGCACCGGACACCGGACTGCCACTGATATGACCAGATGACCAGTACAACACGTATCCGTG

Full Affymetrix probeset data:

Annotations for 1625051_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime