Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625052_at:

>probe:Drosophila_2:1625052_at:666:95; Interrogation_Position=1003; Antisense; AGATAGCCGCCAGTTGATCGCAGAC
>probe:Drosophila_2:1625052_at:128:581; Interrogation_Position=1031; Antisense; TGGCCGCAGGTATTCGATGACTCCG
>probe:Drosophila_2:1625052_at:452:217; Interrogation_Position=1085; Antisense; AAGTACGACCTGTCCAACCTGGTGG
>probe:Drosophila_2:1625052_at:202:279; Interrogation_Position=1138; Antisense; CTACATTAATGTTCAGCCGGAGCAG
>probe:Drosophila_2:1625052_at:579:351; Interrogation_Position=1162; Antisense; GCAGACTCTGCAGATCTAAGACGTG
>probe:Drosophila_2:1625052_at:411:407; Interrogation_Position=1181; Antisense; GACGTGGATCGAACAACCGCATCTA
>probe:Drosophila_2:1625052_at:644:95; Interrogation_Position=754; Antisense; AGATTACGCTGTGGCCGTGTTCCAT
>probe:Drosophila_2:1625052_at:380:291; Interrogation_Position=769; Antisense; CGTGTTCCATGAAGCGCTGCGCAAT
>probe:Drosophila_2:1625052_at:419:249; Interrogation_Position=790; Antisense; CAATGGAAAGTACACCTGCTACCTG
>probe:Drosophila_2:1625052_at:524:625; Interrogation_Position=817; Antisense; TCCTGACACAAGACTGCCCATGATG
>probe:Drosophila_2:1625052_at:21:615; Interrogation_Position=847; Antisense; TGAAGATTGTTTGCGGGCTCTCCTC
>probe:Drosophila_2:1625052_at:197:329; Interrogation_Position=880; Antisense; GCGTGCTCCCAACGAACAGCTGAAG
>probe:Drosophila_2:1625052_at:125:615; Interrogation_Position=900; Antisense; TGAAGCGCCGCGTCTACAACGTGAC
>probe:Drosophila_2:1625052_at:167:617; Interrogation_Position=984; Antisense; TGCACGTGACCTACAAGCCAGATAG

Paste this into a BLAST search page for me
AGATAGCCGCCAGTTGATCGCAGACTGGCCGCAGGTATTCGATGACTCCGAAGTACGACCTGTCCAACCTGGTGGCTACATTAATGTTCAGCCGGAGCAGGCAGACTCTGCAGATCTAAGACGTGGACGTGGATCGAACAACCGCATCTAAGATTACGCTGTGGCCGTGTTCCATCGTGTTCCATGAAGCGCTGCGCAATCAATGGAAAGTACACCTGCTACCTGTCCTGACACAAGACTGCCCATGATGTGAAGATTGTTTGCGGGCTCTCCTCGCGTGCTCCCAACGAACAGCTGAAGTGAAGCGCCGCGTCTACAACGTGACTGCACGTGACCTACAAGCCAGATAG

Full Affymetrix probeset data:

Annotations for 1625052_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime