FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625053_at:

>probe:Drosophila_2:1625053_at:297:501; Interrogation_Position=1042; Antisense; GTCGATTCATGTGTCTGTTAGCCCA
>probe:Drosophila_2:1625053_at:45:309; Interrogation_Position=1064; Antisense; CCATCTCTTCAAGCCCGTTATAATA
>probe:Drosophila_2:1625053_at:255:513; Interrogation_Position=1104; Antisense; GTGAGCTCAGACTTCTCAAGTGTCT
>probe:Drosophila_2:1625053_at:151:435; Interrogation_Position=1143; Antisense; GAGGGCATTCGATTCCAGAAAGCTA
>probe:Drosophila_2:1625053_at:657:391; Interrogation_Position=1160; Antisense; GAAAGCTATCTATGCCAACGAAAGG
>probe:Drosophila_2:1625053_at:139:443; Interrogation_Position=807; Antisense; GATGATGCGAGCAATCCCCAATCAG
>probe:Drosophila_2:1625053_at:149:35; Interrogation_Position=827; Antisense; ATCAGCCGTAGCCATAGACTTTCAA
>probe:Drosophila_2:1625053_at:524:403; Interrogation_Position=843; Antisense; GACTTTCAATTCAGCAACTTCACCT
>probe:Drosophila_2:1625053_at:465:199; Interrogation_Position=876; Antisense; AACGACTTGCATCAATTCTTCACCG
>probe:Drosophila_2:1625053_at:42:645; Interrogation_Position=892; Antisense; TCTTCACCGTTTCACTGCGAGATGA
>probe:Drosophila_2:1625053_at:284:401; Interrogation_Position=924; Antisense; GACATGGAATCCGTTCTTGTTGAGA
>probe:Drosophila_2:1625053_at:627:627; Interrogation_Position=954; Antisense; TACAGCGACCTCAAAACGAACGTGG
>probe:Drosophila_2:1625053_at:200:137; Interrogation_Position=969; Antisense; ACGAACGTGGATACTCTGTCCTATA
>probe:Drosophila_2:1625053_at:562:79; Interrogation_Position=994; Antisense; AGGGAATATTTCCTAGTCTCCAGGG

Paste this into a BLAST search page for me
GTCGATTCATGTGTCTGTTAGCCCACCATCTCTTCAAGCCCGTTATAATAGTGAGCTCAGACTTCTCAAGTGTCTGAGGGCATTCGATTCCAGAAAGCTAGAAAGCTATCTATGCCAACGAAAGGGATGATGCGAGCAATCCCCAATCAGATCAGCCGTAGCCATAGACTTTCAAGACTTTCAATTCAGCAACTTCACCTAACGACTTGCATCAATTCTTCACCGTCTTCACCGTTTCACTGCGAGATGAGACATGGAATCCGTTCTTGTTGAGATACAGCGACCTCAAAACGAACGTGGACGAACGTGGATACTCTGTCCTATAAGGGAATATTTCCTAGTCTCCAGGG

Full Affymetrix probeset data:

Annotations for 1625053_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720