FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625054_at:

>probe:Drosophila_2:1625054_at:271:643; Interrogation_Position=1002; Antisense; TCTACTCTTGCTACCACCCTAAATG
>probe:Drosophila_2:1625054_at:219:307; Interrogation_Position=1019; Antisense; CCTAAATGCCCGCTGCATGCGAAGA
>probe:Drosophila_2:1625054_at:466:165; Interrogation_Position=1022; Antisense; AAATGCCCGCTGCATGCGAAGACCT
>probe:Drosophila_2:1625054_at:477:303; Interrogation_Position=1028; Antisense; CCGCTGCATGCGAAGACCTGTTAGT
>probe:Drosophila_2:1625054_at:241:335; Interrogation_Position=1030; Antisense; GCTGCATGCGAAGACCTGTTAGTTA
>probe:Drosophila_2:1625054_at:338:619; Interrogation_Position=1032; Antisense; TGCATGCGAAGACCTGTTAGTTAAT
>probe:Drosophila_2:1625054_at:692:373; Interrogation_Position=1039; Antisense; GAAGACCTGTTAGTTAATGAATGTA
>probe:Drosophila_2:1625054_at:159:231; Interrogation_Position=1054; Antisense; AATGAATGTATTCTCTCGTTTTGCT
>probe:Drosophila_2:1625054_at:379:217; Interrogation_Position=972; Antisense; AAGGTAGGTGCAGTAAGTTTCCGAT
>probe:Drosophila_2:1625054_at:730:509; Interrogation_Position=979; Antisense; GTGCAGTAAGTTTCCGATTCGTTTC
>probe:Drosophila_2:1625054_at:700:655; Interrogation_Position=985; Antisense; TAAGTTTCCGATTCGTTTCTACTCT
>probe:Drosophila_2:1625054_at:23:91; Interrogation_Position=987; Antisense; AGTTTCCGATTCGTTTCTACTCTTG
>probe:Drosophila_2:1625054_at:541:717; Interrogation_Position=990; Antisense; TTCCGATTCGTTTCTACTCTTGCTA
>probe:Drosophila_2:1625054_at:551:463; Interrogation_Position=994; Antisense; GATTCGTTTCTACTCTTGCTACCAC

Paste this into a BLAST search page for me
TCTACTCTTGCTACCACCCTAAATGCCTAAATGCCCGCTGCATGCGAAGAAAATGCCCGCTGCATGCGAAGACCTCCGCTGCATGCGAAGACCTGTTAGTGCTGCATGCGAAGACCTGTTAGTTATGCATGCGAAGACCTGTTAGTTAATGAAGACCTGTTAGTTAATGAATGTAAATGAATGTATTCTCTCGTTTTGCTAAGGTAGGTGCAGTAAGTTTCCGATGTGCAGTAAGTTTCCGATTCGTTTCTAAGTTTCCGATTCGTTTCTACTCTAGTTTCCGATTCGTTTCTACTCTTGTTCCGATTCGTTTCTACTCTTGCTAGATTCGTTTCTACTCTTGCTACCAC

Full Affymetrix probeset data:

Annotations for 1625054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720