Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625055_at:

>probe:Drosophila_2:1625055_at:496:311; Interrogation_Position=1080; Antisense; GCCTTTAAGGCCAGCGACATTCAAC
>probe:Drosophila_2:1625055_at:167:13; Interrogation_Position=1098; Antisense; ATTCAACTGGAGTTCGTGCGCATCG
>probe:Drosophila_2:1625055_at:146:615; Interrogation_Position=1144; Antisense; TGAAGCAAACGAACACGGGCGCCTA
>probe:Drosophila_2:1625055_at:225:301; Interrogation_Position=1163; Antisense; CGCCTACCAGGCCAAATTCAAGATA
>probe:Drosophila_2:1625055_at:288:499; Interrogation_Position=1194; Antisense; GTCTACGGCGTTTATCAGTTCAAGG
>probe:Drosophila_2:1625055_at:161:533; Interrogation_Position=1217; Antisense; GGTGGACTACAATCGCGTGGGCTAC
>probe:Drosophila_2:1625055_at:50:519; Interrogation_Position=1233; Antisense; GTGGGCTACACGCATCTGTACAGCA
>probe:Drosophila_2:1625055_at:297:421; Interrogation_Position=1284; Antisense; GAGCACACACAGTACGAGCGCTTTA
>probe:Drosophila_2:1625055_at:19:129; Interrogation_Position=1332; Antisense; ACCAGCGCCTTCTCAATGATGATCG
>probe:Drosophila_2:1625055_at:703:441; Interrogation_Position=1349; Antisense; GATGATCGGCGTGTTTGTCTTCTCA
>probe:Drosophila_2:1625055_at:582:9; Interrogation_Position=1373; Antisense; ATTCGTGTTCCTTCACTTCAAGGAT
>probe:Drosophila_2:1625055_at:264:485; Interrogation_Position=1439; Antisense; GTAGTATGCACGTTCGTTCAACTCA
>probe:Drosophila_2:1625055_at:596:19; Interrogation_Position=935; Antisense; ATTTGGAGAGACTGGCCGCTTGCGC
>probe:Drosophila_2:1625055_at:603:521; Interrogation_Position=960; Antisense; GTGGCATCCGTGCAACATCACAAGG

Paste this into a BLAST search page for me
GCCTTTAAGGCCAGCGACATTCAACATTCAACTGGAGTTCGTGCGCATCGTGAAGCAAACGAACACGGGCGCCTACGCCTACCAGGCCAAATTCAAGATAGTCTACGGCGTTTATCAGTTCAAGGGGTGGACTACAATCGCGTGGGCTACGTGGGCTACACGCATCTGTACAGCAGAGCACACACAGTACGAGCGCTTTAACCAGCGCCTTCTCAATGATGATCGGATGATCGGCGTGTTTGTCTTCTCAATTCGTGTTCCTTCACTTCAAGGATGTAGTATGCACGTTCGTTCAACTCAATTTGGAGAGACTGGCCGCTTGCGCGTGGCATCCGTGCAACATCACAAGG

Full Affymetrix probeset data:

Annotations for 1625055_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime