FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625056_at:

>probe:Drosophila_2:1625056_at:283:291; Interrogation_Position=133; Antisense; CGTCAATGCGGCTTCAATGCGTTCG
>probe:Drosophila_2:1625056_at:47:345; Interrogation_Position=168; Antisense; GCTTGACTTCTATTACGCGGCAGGT
>probe:Drosophila_2:1625056_at:117:443; Interrogation_Position=227; Antisense; GATGTGGCGAAGACGGCATCTCCGT
>probe:Drosophila_2:1625056_at:433:283; Interrogation_Position=259; Antisense; CTGCCATCTGCAAGCGAACCTGAAA
>probe:Drosophila_2:1625056_at:658:263; Interrogation_Position=304; Antisense; CAGCTTTGTTGGCTATTCGGGCTTC
>probe:Drosophila_2:1625056_at:36:289; Interrogation_Position=321; Antisense; CGGGCTTCTTTTGGCTAGCGAACGA
>probe:Drosophila_2:1625056_at:150:623; Interrogation_Position=369; Antisense; TGCGGGAAGCTGCACATTTCCAGTT
>probe:Drosophila_2:1625056_at:320:19; Interrogation_Position=384; Antisense; ATTTCCAGTTCCATCAGGTCTGCAG
>probe:Drosophila_2:1625056_at:94:643; Interrogation_Position=402; Antisense; TCTGCAGCTCTTTGTTCTTGGGATA
>probe:Drosophila_2:1625056_at:624:727; Interrogation_Position=419; Antisense; TTGGGATAGGTCAGGCACTGGCCAC
>probe:Drosophila_2:1625056_at:467:721; Interrogation_Position=448; Antisense; TTCCTTGAAGTGGTCGCCGTGTTAA
>probe:Drosophila_2:1625056_at:252:603; Interrogation_Position=467; Antisense; TGTTAACACTGAAGACTGAGCCCGT
>probe:Drosophila_2:1625056_at:520:473; Interrogation_Position=490; Antisense; GTTCATCGTTCACTGCCATTGTGTT
>probe:Drosophila_2:1625056_at:381:241; Interrogation_Position=76; Antisense; AATTTGCACCTGAACCAGTTGGCTC

Paste this into a BLAST search page for me
CGTCAATGCGGCTTCAATGCGTTCGGCTTGACTTCTATTACGCGGCAGGTGATGTGGCGAAGACGGCATCTCCGTCTGCCATCTGCAAGCGAACCTGAAACAGCTTTGTTGGCTATTCGGGCTTCCGGGCTTCTTTTGGCTAGCGAACGATGCGGGAAGCTGCACATTTCCAGTTATTTCCAGTTCCATCAGGTCTGCAGTCTGCAGCTCTTTGTTCTTGGGATATTGGGATAGGTCAGGCACTGGCCACTTCCTTGAAGTGGTCGCCGTGTTAATGTTAACACTGAAGACTGAGCCCGTGTTCATCGTTCACTGCCATTGTGTTAATTTGCACCTGAACCAGTTGGCTC

Full Affymetrix probeset data:

Annotations for 1625056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720