Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625057_at:

>probe:Drosophila_2:1625057_at:387:341; Interrogation_Position=1378; Antisense; GCTTTGGTTGCCTACTACGATCAGT
>probe:Drosophila_2:1625057_at:340:547; Interrogation_Position=1412; Antisense; TCGATTACTTTATAACCTCGCCCGA
>probe:Drosophila_2:1625057_at:278:235; Interrogation_Position=1444; Antisense; AATCCTTGGCAAACAGACAGCACCG
>probe:Drosophila_2:1625057_at:169:173; Interrogation_Position=1495; Antisense; AAAGAAGTTCCTGTGCGGCGCGTGA
>probe:Drosophila_2:1625057_at:105:429; Interrogation_Position=1543; Antisense; GAGTTACTGAACGATGCCATTGGAC
>probe:Drosophila_2:1625057_at:448:729; Interrogation_Position=1562; Antisense; TTGGACGCGAGCAGTTCACCAAGTT
>probe:Drosophila_2:1625057_at:348:71; Interrogation_Position=1646; Antisense; AGGCGCTGCCGCAGTCGGAGATCAA
>probe:Drosophila_2:1625057_at:248:597; Interrogation_Position=1720; Antisense; TGTCCGGTCAACGTGGACTCCAAGT
>probe:Drosophila_2:1625057_at:217:237; Interrogation_Position=1789; Antisense; AATCGTTGGTGCTTCGATGTGGCCG
>probe:Drosophila_2:1625057_at:721:315; Interrogation_Position=1813; Antisense; GCCTCGCATGTATATCACCTGATGA
>probe:Drosophila_2:1625057_at:341:615; Interrogation_Position=1835; Antisense; TGAAGAGCGACTCGTACTCCAGGTA
>probe:Drosophila_2:1625057_at:667:267; Interrogation_Position=1854; Antisense; CAGGTACCTGCGATCCGATATGTAT
>probe:Drosophila_2:1625057_at:114:225; Interrogation_Position=1879; Antisense; AAGGATTATCTGAACTGCTCGCGCA
>probe:Drosophila_2:1625057_at:284:455; Interrogation_Position=1908; Antisense; GATCAAGTCCATACCGAATCTGTTC

Paste this into a BLAST search page for me
GCTTTGGTTGCCTACTACGATCAGTTCGATTACTTTATAACCTCGCCCGAAATCCTTGGCAAACAGACAGCACCGAAAGAAGTTCCTGTGCGGCGCGTGAGAGTTACTGAACGATGCCATTGGACTTGGACGCGAGCAGTTCACCAAGTTAGGCGCTGCCGCAGTCGGAGATCAATGTCCGGTCAACGTGGACTCCAAGTAATCGTTGGTGCTTCGATGTGGCCGGCCTCGCATGTATATCACCTGATGATGAAGAGCGACTCGTACTCCAGGTACAGGTACCTGCGATCCGATATGTATAAGGATTATCTGAACTGCTCGCGCAGATCAAGTCCATACCGAATCTGTTC

Full Affymetrix probeset data:

Annotations for 1625057_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime