Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625058_at:

>probe:Drosophila_2:1625058_at:379:259; Interrogation_Position=1205; Antisense; CACTGAGTGCTTTGAACCGGCAGCA
>probe:Drosophila_2:1625058_at:535:43; Interrogation_Position=1312; Antisense; ATCGATGGCAGGAACAACGTCTACT
>probe:Drosophila_2:1625058_at:629:227; Interrogation_Position=1348; Antisense; AATCCCGTCAAGCTCTTTGTGTGGA
>probe:Drosophila_2:1625058_at:186:517; Interrogation_Position=1368; Antisense; GTGGAACGTGAACTCGCCGTACAAT
>probe:Drosophila_2:1625058_at:491:245; Interrogation_Position=1390; Antisense; AATTCGCGAAACTTTGGCAATCTGC
>probe:Drosophila_2:1625058_at:415:131; Interrogation_Position=1430; Antisense; ACCTGCAGTTCGTCAGCGGCATGAA
>probe:Drosophila_2:1625058_at:66:439; Interrogation_Position=1480; Antisense; GAGGAACTCTGGATGCTCTCCAATC
>probe:Drosophila_2:1625058_at:702:387; Interrogation_Position=1512; Antisense; GAAAATCGCCGCAGGTACGCTGAAC
>probe:Drosophila_2:1625058_at:495:371; Interrogation_Position=1539; Antisense; GAAGGAGGTCAACTTCCGCATCCTG
>probe:Drosophila_2:1625058_at:586:283; Interrogation_Position=1561; Antisense; CTGCGCCGCAAGTTGGATGATGTCC
>probe:Drosophila_2:1625058_at:536:409; Interrogation_Position=1609; Antisense; GACGAGGATCTAACCAATCGCCTGG
>probe:Drosophila_2:1625058_at:665:235; Interrogation_Position=1624; Antisense; AATCGCCTGGTGTTTAGCTAGTGAC
>probe:Drosophila_2:1625058_at:624:677; Interrogation_Position=1683; Antisense; TAGTTTTGTTGTGCACTTCACTGGG
>probe:Drosophila_2:1625058_at:714:623; Interrogation_Position=1715; Antisense; TGCGAATTCCGCCTAAGTGCTAATA

Paste this into a BLAST search page for me
CACTGAGTGCTTTGAACCGGCAGCAATCGATGGCAGGAACAACGTCTACTAATCCCGTCAAGCTCTTTGTGTGGAGTGGAACGTGAACTCGCCGTACAATAATTCGCGAAACTTTGGCAATCTGCACCTGCAGTTCGTCAGCGGCATGAAGAGGAACTCTGGATGCTCTCCAATCGAAAATCGCCGCAGGTACGCTGAACGAAGGAGGTCAACTTCCGCATCCTGCTGCGCCGCAAGTTGGATGATGTCCGACGAGGATCTAACCAATCGCCTGGAATCGCCTGGTGTTTAGCTAGTGACTAGTTTTGTTGTGCACTTCACTGGGTGCGAATTCCGCCTAAGTGCTAATA

Full Affymetrix probeset data:

Annotations for 1625058_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime