Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625059_at:

>probe:Drosophila_2:1625059_at:541:317; Interrogation_Position=115; Antisense; GCCGGCACCGATTTCTGAACAGGAT
>probe:Drosophila_2:1625059_at:104:427; Interrogation_Position=143; Antisense; GAGTTGGCAACCTGTGAGCTGCAGC
>probe:Drosophila_2:1625059_at:411:117; Interrogation_Position=165; Antisense; AGCTCTCCAAGTACCGCAGGTTCAT
>probe:Drosophila_2:1625059_at:55:79; Interrogation_Position=182; Antisense; AGGTTCATCCTGCAGGCCATACTGA
>probe:Drosophila_2:1625059_at:215:693; Interrogation_Position=209; Antisense; TTTGAGGATGTCTGCGACGCGTACA
>probe:Drosophila_2:1625059_at:680:9; Interrogation_Position=255; Antisense; ATTCGGACTCGGAGGGATGGCCCTT
>probe:Drosophila_2:1625059_at:89:339; Interrogation_Position=340; Antisense; GCTAATGGCCCAGTTCGGTGACAAG
>probe:Drosophila_2:1625059_at:539:511; Interrogation_Position=357; Antisense; GTGACAAGGAGTTCTCGCCCATCAT
>probe:Drosophila_2:1625059_at:333:611; Interrogation_Position=397; Antisense; TGAAAGGTGCCGCATCAAATCCCAG
>probe:Drosophila_2:1625059_at:571:357; Interrogation_Position=441; Antisense; GCAACTCCGTCGTGCTGGGCAAGAA
>probe:Drosophila_2:1625059_at:112:211; Interrogation_Position=461; Antisense; AAGAAGCAGCGATTCCACTCGTGGG
>probe:Drosophila_2:1625059_at:25:97; Interrogation_Position=54; Antisense; AGATAGTCCTGTGTATGGTGCTCCT
>probe:Drosophila_2:1625059_at:692:33; Interrogation_Position=549; Antisense; ATCGTTTTTCCCATCCAAGTGTATG
>probe:Drosophila_2:1625059_at:172:303; Interrogation_Position=80; Antisense; GCCTTTGGCCGTCAAGTCTATGGAG

Paste this into a BLAST search page for me
GCCGGCACCGATTTCTGAACAGGATGAGTTGGCAACCTGTGAGCTGCAGCAGCTCTCCAAGTACCGCAGGTTCATAGGTTCATCCTGCAGGCCATACTGATTTGAGGATGTCTGCGACGCGTACAATTCGGACTCGGAGGGATGGCCCTTGCTAATGGCCCAGTTCGGTGACAAGGTGACAAGGAGTTCTCGCCCATCATTGAAAGGTGCCGCATCAAATCCCAGGCAACTCCGTCGTGCTGGGCAAGAAAAGAAGCAGCGATTCCACTCGTGGGAGATAGTCCTGTGTATGGTGCTCCTATCGTTTTTCCCATCCAAGTGTATGGCCTTTGGCCGTCAAGTCTATGGAG

Full Affymetrix probeset data:

Annotations for 1625059_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime