Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625060_at:

>probe:Drosophila_2:1625060_at:265:269; Interrogation_Position=1112; Antisense; CATTAATCGGGCCACTTCTGTAAAA
>probe:Drosophila_2:1625060_at:248:513; Interrogation_Position=572; Antisense; GTGATGTAAACAAGTACCTGACCCC
>probe:Drosophila_2:1625060_at:633:87; Interrogation_Position=638; Antisense; AGTCTTCCTCGCACAGATCGGAGGA
>probe:Drosophila_2:1625060_at:534:443; Interrogation_Position=663; Antisense; GATGTTGTCCAACCAGATGCTCAAT
>probe:Drosophila_2:1625060_at:164:227; Interrogation_Position=685; Antisense; AATGGCATTCCTGAAGTGGACCTGG
>probe:Drosophila_2:1625060_at:195:587; Interrogation_Position=701; Antisense; TGGACCTGGGCATTGTGGCCAAGAT
>probe:Drosophila_2:1625060_at:231:97; Interrogation_Position=722; Antisense; AGATCCGCAACATAGAGGCCACCGA
>probe:Drosophila_2:1625060_at:149:159; Interrogation_Position=782; Antisense; ACAAGAAGGACGGACCCTCGCAATT
>probe:Drosophila_2:1625060_at:254:717; Interrogation_Position=805; Antisense; TTCGTGCCCACCAACATGGCGGTGA
>probe:Drosophila_2:1625060_at:252:67; Interrogation_Position=820; Antisense; ATGGCGGTGAACTTCATGCAACACA
>probe:Drosophila_2:1625060_at:223:435; Interrogation_Position=901; Antisense; GAGGGCAACAAATCCGCACAGCATC
>probe:Drosophila_2:1625060_at:357:357; Interrogation_Position=916; Antisense; GCACAGCATCAGACGAATCCCAATG
>probe:Drosophila_2:1625060_at:637:65; Interrogation_Position=938; Antisense; ATGGAGTCAAGCGAGCCACAGATGA
>probe:Drosophila_2:1625060_at:87:377; Interrogation_Position=984; Antisense; GAAGCAGTTCCGCAGATACTAAAGA

Paste this into a BLAST search page for me
CATTAATCGGGCCACTTCTGTAAAAGTGATGTAAACAAGTACCTGACCCCAGTCTTCCTCGCACAGATCGGAGGAGATGTTGTCCAACCAGATGCTCAATAATGGCATTCCTGAAGTGGACCTGGTGGACCTGGGCATTGTGGCCAAGATAGATCCGCAACATAGAGGCCACCGAACAAGAAGGACGGACCCTCGCAATTTTCGTGCCCACCAACATGGCGGTGAATGGCGGTGAACTTCATGCAACACAGAGGGCAACAAATCCGCACAGCATCGCACAGCATCAGACGAATCCCAATGATGGAGTCAAGCGAGCCACAGATGAGAAGCAGTTCCGCAGATACTAAAGA

Full Affymetrix probeset data:

Annotations for 1625060_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime