Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625061_at:

>probe:Drosophila_2:1625061_at:441:269; Interrogation_Position=207; Antisense; CATCCATCATGGAGCCCACTCGGTG
>probe:Drosophila_2:1625061_at:350:535; Interrogation_Position=228; Antisense; GGTGCACTCCCATGTTGTTCATCAT
>probe:Drosophila_2:1625061_at:142:59; Interrogation_Position=239; Antisense; ATGTTGTTCATCATCCGGCAGCCGT
>probe:Drosophila_2:1625061_at:634:631; Interrogation_Position=252; Antisense; TCCGGCAGCCGTCAAGGTCATCACA
>probe:Drosophila_2:1625061_at:541:237; Interrogation_Position=31; Antisense; AATCATTAGCCTAGCTACCTTTCCT
>probe:Drosophila_2:1625061_at:711:283; Interrogation_Position=311; Antisense; CTGTCAGGCCGGTGGTTCCATTGGT
>probe:Drosophila_2:1625061_at:112:471; Interrogation_Position=325; Antisense; GTTCCATTGGTTCCAGTGCATCATG
>probe:Drosophila_2:1625061_at:574:317; Interrogation_Position=358; Antisense; GCCGTCGTCGTGCATCATTAAGTGC
>probe:Drosophila_2:1625061_at:704:351; Interrogation_Position=381; Antisense; GCAGCGAATACGGTTCACTTTCAAT
>probe:Drosophila_2:1625061_at:2:677; Interrogation_Position=42; Antisense; TAGCTACCTTTCCTACTTCAGTTAT
>probe:Drosophila_2:1625061_at:379:271; Interrogation_Position=471; Antisense; CATAACCACGATCCCACAATAAAAG
>probe:Drosophila_2:1625061_at:655:641; Interrogation_Position=55; Antisense; TACTTCAGTTATCCCGCCAAAATCC
>probe:Drosophila_2:1625061_at:457:47; Interrogation_Position=76; Antisense; ATCCAACGCCTCAAAATGTTCAAAG
>probe:Drosophila_2:1625061_at:697:471; Interrogation_Position=93; Antisense; GTTCAAAGTACTGTTCGTGCTCGCC

Paste this into a BLAST search page for me
CATCCATCATGGAGCCCACTCGGTGGGTGCACTCCCATGTTGTTCATCATATGTTGTTCATCATCCGGCAGCCGTTCCGGCAGCCGTCAAGGTCATCACAAATCATTAGCCTAGCTACCTTTCCTCTGTCAGGCCGGTGGTTCCATTGGTGTTCCATTGGTTCCAGTGCATCATGGCCGTCGTCGTGCATCATTAAGTGCGCAGCGAATACGGTTCACTTTCAATTAGCTACCTTTCCTACTTCAGTTATCATAACCACGATCCCACAATAAAAGTACTTCAGTTATCCCGCCAAAATCCATCCAACGCCTCAAAATGTTCAAAGGTTCAAAGTACTGTTCGTGCTCGCC

Full Affymetrix probeset data:

Annotations for 1625061_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime