Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625062_a_at:

>probe:Drosophila_2:1625062_a_at:380:313; Interrogation_Position=13; Antisense; GCCACGTGCCAGAACACTGAACATT
>probe:Drosophila_2:1625062_a_at:545:451; Interrogation_Position=154; Antisense; GATCTCTAGAGATGCTTTGCCAGCG
>probe:Drosophila_2:1625062_a_at:162:573; Interrogation_Position=184; Antisense; GGCTCCTTCGGAAATGCCCACGAAG
>probe:Drosophila_2:1625062_a_at:99:295; Interrogation_Position=204; Antisense; CGAAGCCCCAGGAAGTGGCGACCGA
>probe:Drosophila_2:1625062_a_at:105:295; Interrogation_Position=226; Antisense; CGAGGAGCCCAGTGTCCAGTGGAAT
>probe:Drosophila_2:1625062_a_at:128:541; Interrogation_Position=261; Antisense; GGATTGGCTTGGCACACTTGCTAAT
>probe:Drosophila_2:1625062_a_at:332:455; Interrogation_Position=286; Antisense; GATAATTTCTTGCATGCGCGGACTC
>probe:Drosophila_2:1625062_a_at:285:323; Interrogation_Position=301; Antisense; GCGCGGACTCTTTTAAACAGGCATT
>probe:Drosophila_2:1625062_a_at:429:385; Interrogation_Position=31; Antisense; GAACATTCACCAAATTTCTCTCATT
>probe:Drosophila_2:1625062_a_at:305:383; Interrogation_Position=334; Antisense; GAACGTCTGAATACTGCTGTGAACT
>probe:Drosophila_2:1625062_a_at:163:145; Interrogation_Position=346; Antisense; ACTGCTGTGAACTCTGATGCATTAA
>probe:Drosophila_2:1625062_a_at:6:103; Interrogation_Position=56; Antisense; AGAGCGTTTCTCTAGGATAACCCAA
>probe:Drosophila_2:1625062_a_at:381:77; Interrogation_Position=69; Antisense; AGGATAACCCAACCCATACAATGTG
>probe:Drosophila_2:1625062_a_at:440:249; Interrogation_Position=98; Antisense; CAATTAGGCTGTCGCGGGCTTGCAA

Paste this into a BLAST search page for me
GCCACGTGCCAGAACACTGAACATTGATCTCTAGAGATGCTTTGCCAGCGGGCTCCTTCGGAAATGCCCACGAAGCGAAGCCCCAGGAAGTGGCGACCGACGAGGAGCCCAGTGTCCAGTGGAATGGATTGGCTTGGCACACTTGCTAATGATAATTTCTTGCATGCGCGGACTCGCGCGGACTCTTTTAAACAGGCATTGAACATTCACCAAATTTCTCTCATTGAACGTCTGAATACTGCTGTGAACTACTGCTGTGAACTCTGATGCATTAAAGAGCGTTTCTCTAGGATAACCCAAAGGATAACCCAACCCATACAATGTGCAATTAGGCTGTCGCGGGCTTGCAA

Full Affymetrix probeset data:

Annotations for 1625062_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime