Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625063_a_at:

>probe:Drosophila_2:1625063_a_at:576:393; Interrogation_Position=178; Antisense; GAAATGGTCAATGCCCTAGAGCCCT
>probe:Drosophila_2:1625063_a_at:616:625; Interrogation_Position=189; Antisense; TGCCCTAGAGCCCTATATCGAATAT
>probe:Drosophila_2:1625063_a_at:254:389; Interrogation_Position=225; Antisense; GAAAACCATGCAGGACTATCTCGAG
>probe:Drosophila_2:1625063_a_at:93:411; Interrogation_Position=258; Antisense; GACCATAGTTACGTCCAGTCGTTTG
>probe:Drosophila_2:1625063_a_at:513:461; Interrogation_Position=308; Antisense; GATTCAATGAACACGGTGACCAGCC
>probe:Drosophila_2:1625063_a_at:108:607; Interrogation_Position=324; Antisense; TGACCAGCCAACTCTAGTCGGATCA
>probe:Drosophila_2:1625063_a_at:79:87; Interrogation_Position=339; Antisense; AGTCGGATCACCCTCCAAGAGGCAG
>probe:Drosophila_2:1625063_a_at:682:101; Interrogation_Position=373; Antisense; AGACCTCTAAACCATTTCCAATCGA
>probe:Drosophila_2:1625063_a_at:690:255; Interrogation_Position=408; Antisense; CAAAGTGTTCACTGAGTTCCATAAA
>probe:Drosophila_2:1625063_a_at:199:173; Interrogation_Position=442; Antisense; AAAGCTGCTGACGACTTGGAGCGAG
>probe:Drosophila_2:1625063_a_at:267:123; Interrogation_Position=461; Antisense; AGCGAGTAGTGCGATTCCCGGATAA
>probe:Drosophila_2:1625063_a_at:395:191; Interrogation_Position=500; Antisense; AACTTTTTGGGCTTCTCGAGCAATA
>probe:Drosophila_2:1625063_a_at:352:641; Interrogation_Position=513; Antisense; TCTCGAGCAATATCGGGCCAGTGGT
>probe:Drosophila_2:1625063_a_at:607:427; Interrogation_Position=556; Antisense; GAGATAGCTTCTCGAATCCTGGCGC

Paste this into a BLAST search page for me
GAAATGGTCAATGCCCTAGAGCCCTTGCCCTAGAGCCCTATATCGAATATGAAAACCATGCAGGACTATCTCGAGGACCATAGTTACGTCCAGTCGTTTGGATTCAATGAACACGGTGACCAGCCTGACCAGCCAACTCTAGTCGGATCAAGTCGGATCACCCTCCAAGAGGCAGAGACCTCTAAACCATTTCCAATCGACAAAGTGTTCACTGAGTTCCATAAAAAAGCTGCTGACGACTTGGAGCGAGAGCGAGTAGTGCGATTCCCGGATAAAACTTTTTGGGCTTCTCGAGCAATATCTCGAGCAATATCGGGCCAGTGGTGAGATAGCTTCTCGAATCCTGGCGC

Full Affymetrix probeset data:

Annotations for 1625063_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime