Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625066_at:

>probe:Drosophila_2:1625066_at:281:625; Interrogation_Position=111; Antisense; TGCCCGGACGGCCATCCAGAAGATA
>probe:Drosophila_2:1625066_at:5:579; Interrogation_Position=120; Antisense; GGCCATCCAGAAGATAATCGACGCT
>probe:Drosophila_2:1625066_at:43:63; Interrogation_Position=13; Antisense; ATGTCGAGAATCCTTGTCGCCGCCA
>probe:Drosophila_2:1625066_at:264:455; Interrogation_Position=132; Antisense; GATAATCGACGCTTACAATCGGATT
>probe:Drosophila_2:1625066_at:100:411; Interrogation_Position=139; Antisense; GACGCTTACAATCGGATTCCGGGTC
>probe:Drosophila_2:1625066_at:504:461; Interrogation_Position=153; Antisense; GATTCCGGGTCCTTCAGTTGTTCAC
>probe:Drosophila_2:1625066_at:178:277; Interrogation_Position=164; Antisense; CTTCAGTTGTTCACCCCTGGGAGGT
>probe:Drosophila_2:1625066_at:258:1; Interrogation_Position=176; Antisense; ACCCCTGGGAGGTGGCCACTTTGAT
>probe:Drosophila_2:1625066_at:432:435; Interrogation_Position=184; Antisense; GAGGTGGCCACTTTGATTGACCCGA
>probe:Drosophila_2:1625066_at:612:521; Interrogation_Position=187; Antisense; GTGGCCACTTTGATTGACCCGAACA
>probe:Drosophila_2:1625066_at:155:605; Interrogation_Position=197; Antisense; TGATTGACCCGAACACCTTTGTGGC
>probe:Drosophila_2:1625066_at:344:45; Interrogation_Position=37; Antisense; ATCGCCTTCGTTACCATCTGTCTGG
>probe:Drosophila_2:1625066_at:674:703; Interrogation_Position=47; Antisense; TTACCATCTGTCTGGTCCTTGTCAG
>probe:Drosophila_2:1625066_at:143:41; Interrogation_Position=52; Antisense; ATCTGTCTGGTCCTTGTCAGCGCCG

Paste this into a BLAST search page for me
TGCCCGGACGGCCATCCAGAAGATAGGCCATCCAGAAGATAATCGACGCTATGTCGAGAATCCTTGTCGCCGCCAGATAATCGACGCTTACAATCGGATTGACGCTTACAATCGGATTCCGGGTCGATTCCGGGTCCTTCAGTTGTTCACCTTCAGTTGTTCACCCCTGGGAGGTACCCCTGGGAGGTGGCCACTTTGATGAGGTGGCCACTTTGATTGACCCGAGTGGCCACTTTGATTGACCCGAACATGATTGACCCGAACACCTTTGTGGCATCGCCTTCGTTACCATCTGTCTGGTTACCATCTGTCTGGTCCTTGTCAGATCTGTCTGGTCCTTGTCAGCGCCG

Full Affymetrix probeset data:

Annotations for 1625066_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime