FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625067_at:

>probe:Drosophila_2:1625067_at:83:201; Interrogation_Position=1237; Antisense; CAATCCGATGTTGACCTTGGTCCGA
>probe:Drosophila_2:1625067_at:66:67; Interrogation_Position=1304; Antisense; ATGGATCTCCGCATTCGTAGAACTG
>probe:Drosophila_2:1625067_at:451:195; Interrogation_Position=1324; Antisense; AACTGTGGTACACGAGCACTTCGAT
>probe:Drosophila_2:1625067_at:294:535; Interrogation_Position=1397; Antisense; GGTGCATTGCCAGGTAACATCTCGC
>probe:Drosophila_2:1625067_at:240:549; Interrogation_Position=1435; Antisense; GGAGGCCGCCAAGTTTATGCAGCAG
>probe:Drosophila_2:1625067_at:140:149; Interrogation_Position=1461; Antisense; ACTTCGTGGGCATGAATCCCTTTGT
>probe:Drosophila_2:1625067_at:116:213; Interrogation_Position=1534; Antisense; AAGAGATGCCCAGGTGCCAATCGTG
>probe:Drosophila_2:1625067_at:212:327; Interrogation_Position=1572; Antisense; GCGAGCAGAGCTACAAGTCCATTTT
>probe:Drosophila_2:1625067_at:194:629; Interrogation_Position=1596; Antisense; TCCAGTTCGTCCAGTTCAGTGACAA
>probe:Drosophila_2:1625067_at:278:119; Interrogation_Position=1637; Antisense; AGCTCGAGCGTGGATGCCTGTCAAG
>probe:Drosophila_2:1625067_at:489:597; Interrogation_Position=1705; Antisense; TGTCTATAGGTTCTACTTGCTCGGC
>probe:Drosophila_2:1625067_at:110:729; Interrogation_Position=1740; Antisense; TTGGCTATGAGTGTGCTCGGCCCAA
>probe:Drosophila_2:1625067_at:580:101; Interrogation_Position=1784; Antisense; AGAGTTGCTTCCTATGTTCCTTGGA
>probe:Drosophila_2:1625067_at:349:33; Interrogation_Position=1808; Antisense; ATCAAGAAACACATCGCATCCGCGT

Paste this into a BLAST search page for me
CAATCCGATGTTGACCTTGGTCCGAATGGATCTCCGCATTCGTAGAACTGAACTGTGGTACACGAGCACTTCGATGGTGCATTGCCAGGTAACATCTCGCGGAGGCCGCCAAGTTTATGCAGCAGACTTCGTGGGCATGAATCCCTTTGTAAGAGATGCCCAGGTGCCAATCGTGGCGAGCAGAGCTACAAGTCCATTTTTCCAGTTCGTCCAGTTCAGTGACAAAGCTCGAGCGTGGATGCCTGTCAAGTGTCTATAGGTTCTACTTGCTCGGCTTGGCTATGAGTGTGCTCGGCCCAAAGAGTTGCTTCCTATGTTCCTTGGAATCAAGAAACACATCGCATCCGCGT

Full Affymetrix probeset data:

Annotations for 1625067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720