Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625072_s_at:

>probe:Drosophila_2:1625072_s_at:685:163; Interrogation_Position=4536; Antisense; AAATATAATCCTTAGAATGCGTTCT
>probe:Drosophila_2:1625072_s_at:99:369; Interrogation_Position=4550; Antisense; GAATGCGTTCTTGGACGTCGTCAAC
>probe:Drosophila_2:1625072_s_at:361:501; Interrogation_Position=4566; Antisense; GTCGTCAACCAACATTATACCTTCA
>probe:Drosophila_2:1625072_s_at:480:179; Interrogation_Position=4614; Antisense; AAACAAACTTATTAGCATTGCATGC
>probe:Drosophila_2:1625072_s_at:167:347; Interrogation_Position=4633; Antisense; GCATGCTTTTTAAAACATTGCAACG
>probe:Drosophila_2:1625072_s_at:393:359; Interrogation_Position=4652; Antisense; GCAACGAATTTTAGCAAACAAACGA
>probe:Drosophila_2:1625072_s_at:40:239; Interrogation_Position=4722; Antisense; AATCTTTTGAATGCGTTTGTCCATC
>probe:Drosophila_2:1625072_s_at:482:369; Interrogation_Position=4730; Antisense; GAATGCGTTTGTCCATCAGTTTTTT
>probe:Drosophila_2:1625072_s_at:456:723; Interrogation_Position=4775; Antisense; TTGCTTTGATGGTTTAAGGCATGAC
>probe:Drosophila_2:1625072_s_at:623:29; Interrogation_Position=4820; Antisense; ATACAAATGATTGGGTTAGCTCGAA
>probe:Drosophila_2:1625072_s_at:669:529; Interrogation_Position=4832; Antisense; GGGTTAGCTCGAAATTCCACAGTTT
>probe:Drosophila_2:1625072_s_at:711:85; Interrogation_Position=4909; Antisense; AGATTGGGTCGTTGTGTTGGTTTCT
>probe:Drosophila_2:1625072_s_at:338:501; Interrogation_Position=4916; Antisense; GTCGTTGTGTTGGTTTCTTCATGGA
>probe:Drosophila_2:1625072_s_at:27:479; Interrogation_Position=4928; Antisense; GTTTCTTCATGGAACCTTAATGTGA

Paste this into a BLAST search page for me
AAATATAATCCTTAGAATGCGTTCTGAATGCGTTCTTGGACGTCGTCAACGTCGTCAACCAACATTATACCTTCAAAACAAACTTATTAGCATTGCATGCGCATGCTTTTTAAAACATTGCAACGGCAACGAATTTTAGCAAACAAACGAAATCTTTTGAATGCGTTTGTCCATCGAATGCGTTTGTCCATCAGTTTTTTTTGCTTTGATGGTTTAAGGCATGACATACAAATGATTGGGTTAGCTCGAAGGGTTAGCTCGAAATTCCACAGTTTAGATTGGGTCGTTGTGTTGGTTTCTGTCGTTGTGTTGGTTTCTTCATGGAGTTTCTTCATGGAACCTTAATGTGA

Full Affymetrix probeset data:

Annotations for 1625072_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime