FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625075_at:

>probe:Drosophila_2:1625075_at:420:641; Interrogation_Position=2210; Antisense; TCTGGCCAAGGCGAAGTGCATCATT
>probe:Drosophila_2:1625075_at:382:219; Interrogation_Position=2258; Antisense; AAGGGCCACGGGATTGAACTTGAAT
>probe:Drosophila_2:1625075_at:317:329; Interrogation_Position=2323; Antisense; GCGTCAAGGAGTCATACATCGCCTA
>probe:Drosophila_2:1625075_at:496:45; Interrogation_Position=2340; Antisense; ATCGCCTACCGCAGATGGGCTGAGA
>probe:Drosophila_2:1625075_at:296:253; Interrogation_Position=2380; Antisense; CAAAGCTTCCGGGATTGGACTACAC
>probe:Drosophila_2:1625075_at:306:667; Interrogation_Position=2400; Antisense; TACACCCCGGAGCAGATGTTCTGGG
>probe:Drosophila_2:1625075_at:596:353; Interrogation_Position=2427; Antisense; GCAGCCGGACAGACTTGGTGTGCTA
>probe:Drosophila_2:1625075_at:622:211; Interrogation_Position=2472; Antisense; AAGATGCGTATTACTACCGGCGTGC
>probe:Drosophila_2:1625075_at:99:225; Interrogation_Position=2541; Antisense; AAGGACTTCGCCAAGGACTTCCATT
>probe:Drosophila_2:1625075_at:29:403; Interrogation_Position=2556; Antisense; GACTTCCATTGTCCAGAGGGATCAC
>probe:Drosophila_2:1625075_at:642:33; Interrogation_Position=2576; Antisense; ATCACCCATGAATCCGGTCCAAAAG
>probe:Drosophila_2:1625075_at:356:71; Interrogation_Position=2605; Antisense; AGGTTTGGTAGGAACTGCTCCGGCA
>probe:Drosophila_2:1625075_at:527:617; Interrogation_Position=2620; Antisense; TGCTCCGGCAGTGACTACAGGGTAT
>probe:Drosophila_2:1625075_at:184:667; Interrogation_Position=2635; Antisense; TACAGGGTATTGTGTCCGCCGTGAC

Paste this into a BLAST search page for me
TCTGGCCAAGGCGAAGTGCATCATTAAGGGCCACGGGATTGAACTTGAATGCGTCAAGGAGTCATACATCGCCTAATCGCCTACCGCAGATGGGCTGAGACAAAGCTTCCGGGATTGGACTACACTACACCCCGGAGCAGATGTTCTGGGGCAGCCGGACAGACTTGGTGTGCTAAAGATGCGTATTACTACCGGCGTGCAAGGACTTCGCCAAGGACTTCCATTGACTTCCATTGTCCAGAGGGATCACATCACCCATGAATCCGGTCCAAAAGAGGTTTGGTAGGAACTGCTCCGGCATGCTCCGGCAGTGACTACAGGGTATTACAGGGTATTGTGTCCGCCGTGAC

Full Affymetrix probeset data:

Annotations for 1625075_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720