FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625076_at:

>probe:Drosophila_2:1625076_at:369:325; Interrogation_Position=2271; Antisense; GCGAATGCCAACGTTGTACGTATCA
>probe:Drosophila_2:1625076_at:426:171; Interrogation_Position=2325; Antisense; AAAGACATGAAATCTGTGCCAAAAA
>probe:Drosophila_2:1625076_at:539:9; Interrogation_Position=2360; Antisense; ATCACTTATGATTTAGCACGTTAAT
>probe:Drosophila_2:1625076_at:187:459; Interrogation_Position=2369; Antisense; GATTTAGCACGTTAATTGTTGAATT
>probe:Drosophila_2:1625076_at:136:321; Interrogation_Position=2448; Antisense; GAATAACACAACACTTAGACCGTAG
>probe:Drosophila_2:1625076_at:34:241; Interrogation_Position=2454; Antisense; CACAACACTTAGACCGTAGTTTAGT
>probe:Drosophila_2:1625076_at:702:653; Interrogation_Position=2479; Antisense; TAACTTTCTGTTGAAGTTCCCTTCG
>probe:Drosophila_2:1625076_at:162:603; Interrogation_Position=2487; Antisense; TGTTGAAGTTCCCTTCGAACCCAAT
>probe:Drosophila_2:1625076_at:667:631; Interrogation_Position=2501; Antisense; TCGAACCCAATCTTTAACGACTCGT
>probe:Drosophila_2:1625076_at:177:663; Interrogation_Position=2537; Antisense; TAAACTGTCGTACGAGTTGGTTGAA
>probe:Drosophila_2:1625076_at:589:451; Interrogation_Position=2552; Antisense; GTTGGTTGAACCATTGCCTTTTATT
>probe:Drosophila_2:1625076_at:76:381; Interrogation_Position=2559; Antisense; GAACCATTGCCTTTTATTAAATATT
>probe:Drosophila_2:1625076_at:389:243; Interrogation_Position=2578; Antisense; AATATTTTGTATACATCCTCATGAC
>probe:Drosophila_2:1625076_at:19:687; Interrogation_Position=2587; Antisense; TATACATCCTCATGACTCACAAACG

Paste this into a BLAST search page for me
GCGAATGCCAACGTTGTACGTATCAAAAGACATGAAATCTGTGCCAAAAAATCACTTATGATTTAGCACGTTAATGATTTAGCACGTTAATTGTTGAATTGAATAACACAACACTTAGACCGTAGCACAACACTTAGACCGTAGTTTAGTTAACTTTCTGTTGAAGTTCCCTTCGTGTTGAAGTTCCCTTCGAACCCAATTCGAACCCAATCTTTAACGACTCGTTAAACTGTCGTACGAGTTGGTTGAAGTTGGTTGAACCATTGCCTTTTATTGAACCATTGCCTTTTATTAAATATTAATATTTTGTATACATCCTCATGACTATACATCCTCATGACTCACAAACG

Full Affymetrix probeset data:

Annotations for 1625076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720