FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625077_at:

>probe:Drosophila_2:1625077_at:359:189; Interrogation_Position=1258; Antisense; AACAGAAGAACCTGGCCATTGCTCT
>probe:Drosophila_2:1625077_at:31:51; Interrogation_Position=1360; Antisense; ATGCGAGTATTCTTATGGGTATTGT
>probe:Drosophila_2:1625077_at:671:63; Interrogation_Position=1374; Antisense; ATGGGTATTGTGAACACGGCTGCGA
>probe:Drosophila_2:1625077_at:678:259; Interrogation_Position=1388; Antisense; CACGGCTGCGAATGTAGTGCCTATA
>probe:Drosophila_2:1625077_at:563:663; Interrogation_Position=1409; Antisense; TATAGTAACCCCTCTGGCTGTTGGA
>probe:Drosophila_2:1625077_at:440:573; Interrogation_Position=1424; Antisense; GGCTGTTGGACTTATTGTTCATGAA
>probe:Drosophila_2:1625077_at:48:623; Interrogation_Position=1487; Antisense; TGCGGCAGTAATTTTCTTTATCGGA
>probe:Drosophila_2:1625077_at:307:79; Interrogation_Position=1582; Antisense; AGGTACCAGACCTAGCTATAGCTCC
>probe:Drosophila_2:1625077_at:227:71; Interrogation_Position=1628; Antisense; AGGCATTGATGGACCTTCTCAGAAG
>probe:Drosophila_2:1625077_at:429:169; Interrogation_Position=1664; Antisense; AAAGTTCCACTAGATCGATAGCACT
>probe:Drosophila_2:1625077_at:461:451; Interrogation_Position=1676; Antisense; GATCGATAGCACTTAAGTCTCCAGT
>probe:Drosophila_2:1625077_at:726:217; Interrogation_Position=1690; Antisense; AAGTCTCCAGTGTACATAGAAACTA
>probe:Drosophila_2:1625077_at:487:163; Interrogation_Position=1738; Antisense; AAATCACCTGACGTGGTATTAGATA
>probe:Drosophila_2:1625077_at:111:567; Interrogation_Position=1764; Antisense; GGCAAATTCGGCTTATCAGCTAATT

Paste this into a BLAST search page for me
AACAGAAGAACCTGGCCATTGCTCTATGCGAGTATTCTTATGGGTATTGTATGGGTATTGTGAACACGGCTGCGACACGGCTGCGAATGTAGTGCCTATATATAGTAACCCCTCTGGCTGTTGGAGGCTGTTGGACTTATTGTTCATGAATGCGGCAGTAATTTTCTTTATCGGAAGGTACCAGACCTAGCTATAGCTCCAGGCATTGATGGACCTTCTCAGAAGAAAGTTCCACTAGATCGATAGCACTGATCGATAGCACTTAAGTCTCCAGTAAGTCTCCAGTGTACATAGAAACTAAAATCACCTGACGTGGTATTAGATAGGCAAATTCGGCTTATCAGCTAATT

Full Affymetrix probeset data:

Annotations for 1625077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720