FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625078_at:

>probe:Drosophila_2:1625078_at:328:5; Interrogation_Position=1036; Antisense; ATTGTGATCAAGAACTCGCCGCTGA
>probe:Drosophila_2:1625078_at:682:633; Interrogation_Position=1051; Antisense; TCGCCGCTGACCAACATTATGATGA
>probe:Drosophila_2:1625078_at:2:595; Interrogation_Position=1127; Antisense; TGGGCACCGCCACCGTATTGGAGAA
>probe:Drosophila_2:1625078_at:279:167; Interrogation_Position=1154; Antisense; AAATGCGTAGCCTGATCGAGCGCGT
>probe:Drosophila_2:1625078_at:440:123; Interrogation_Position=1172; Antisense; AGCGCGTCGACGAGTTGTACCAGGA
>probe:Drosophila_2:1625078_at:132:439; Interrogation_Position=1195; Antisense; GAGGCAGTGCGCTATAACAAGTACC
>probe:Drosophila_2:1625078_at:316:309; Interrogation_Position=1218; Antisense; CCAGCAGGTGGTCTTCAAGCAGGAT
>probe:Drosophila_2:1625078_at:133:377; Interrogation_Position=1248; Antisense; GAAGCACCGTGCTCTGGCTAAGCTG
>probe:Drosophila_2:1625078_at:525:717; Interrogation_Position=1289; Antisense; TTCGCACATCGAAGGGAGAGCCCAC
>probe:Drosophila_2:1625078_at:453:373; Interrogation_Position=1327; Antisense; GAAGTGATCAAACAGTTCCGCCCCA
>probe:Drosophila_2:1625078_at:453:31; Interrogation_Position=1381; Antisense; ATAACCTCTGGCCAGATCAATACCC
>probe:Drosophila_2:1625078_at:329:357; Interrogation_Position=1420; Antisense; GCACAATTCTGTTCGCAATCGCTGG
>probe:Drosophila_2:1625078_at:34:179; Interrogation_Position=1447; Antisense; AAACTCTTCATCACGGAATCGCTGC
>probe:Drosophila_2:1625078_at:88:205; Interrogation_Position=1517; Antisense; AAGCGTTTTTTAAGCTGAGGCAACA

Paste this into a BLAST search page for me
ATTGTGATCAAGAACTCGCCGCTGATCGCCGCTGACCAACATTATGATGATGGGCACCGCCACCGTATTGGAGAAAAATGCGTAGCCTGATCGAGCGCGTAGCGCGTCGACGAGTTGTACCAGGAGAGGCAGTGCGCTATAACAAGTACCCCAGCAGGTGGTCTTCAAGCAGGATGAAGCACCGTGCTCTGGCTAAGCTGTTCGCACATCGAAGGGAGAGCCCACGAAGTGATCAAACAGTTCCGCCCCAATAACCTCTGGCCAGATCAATACCCGCACAATTCTGTTCGCAATCGCTGGAAACTCTTCATCACGGAATCGCTGCAAGCGTTTTTTAAGCTGAGGCAACA

Full Affymetrix probeset data:

Annotations for 1625078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720