FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625079_at:

>probe:Drosophila_2:1625079_at:66:237; Interrogation_Position=2560; Antisense; AATCCCTTCCTGAGCGACGAGGATG
>probe:Drosophila_2:1625079_at:82:721; Interrogation_Position=2660; Antisense; TTGCACATATCTCTAACCTGGTCAG
>probe:Drosophila_2:1625079_at:64:537; Interrogation_Position=2679; Antisense; GGTCAGCCTGCAGATCGATCACTAC
>probe:Drosophila_2:1625079_at:651:619; Interrogation_Position=2717; Antisense; TGCTGCGCCTCGCTGAGGAATTGAA
>probe:Drosophila_2:1625079_at:211:381; Interrogation_Position=2739; Antisense; GAACGAAATGTCTACCTTCCTGAAC
>probe:Drosophila_2:1625079_at:460:555; Interrogation_Position=2766; Antisense; GGACGCCGAGCGCATATTGCAAAAG
>probe:Drosophila_2:1625079_at:553:685; Interrogation_Position=2806; Antisense; TATACCATATCCAGCAGTCCATTTC
>probe:Drosophila_2:1625079_at:45:29; Interrogation_Position=2878; Antisense; ATAATATTTGGGTGCGTTGTGCCGC
>probe:Drosophila_2:1625079_at:92:729; Interrogation_Position=2894; Antisense; TTGTGCCGCAGATCGAGGTGACGCT
>probe:Drosophila_2:1625079_at:543:435; Interrogation_Position=2908; Antisense; GAGGTGACGCTCGTGATGCCATCGC
>probe:Drosophila_2:1625079_at:226:311; Interrogation_Position=2925; Antisense; GCCATCGCCAACACCTGGTAAGGAA
>probe:Drosophila_2:1625079_at:283:439; Interrogation_Position=2962; Antisense; GATGCTGAAAGTGTCGTACCCGATT
>probe:Drosophila_2:1625079_at:682:493; Interrogation_Position=2974; Antisense; GTCGTACCCGATTCAGCTAGTTTGG
>probe:Drosophila_2:1625079_at:396:23; Interrogation_Position=3032; Antisense; ATATCTTTTGTTGTCTCTTCTTCAA

Paste this into a BLAST search page for me
AATCCCTTCCTGAGCGACGAGGATGTTGCACATATCTCTAACCTGGTCAGGGTCAGCCTGCAGATCGATCACTACTGCTGCGCCTCGCTGAGGAATTGAAGAACGAAATGTCTACCTTCCTGAACGGACGCCGAGCGCATATTGCAAAAGTATACCATATCCAGCAGTCCATTTCATAATATTTGGGTGCGTTGTGCCGCTTGTGCCGCAGATCGAGGTGACGCTGAGGTGACGCTCGTGATGCCATCGCGCCATCGCCAACACCTGGTAAGGAAGATGCTGAAAGTGTCGTACCCGATTGTCGTACCCGATTCAGCTAGTTTGGATATCTTTTGTTGTCTCTTCTTCAA

Full Affymetrix probeset data:

Annotations for 1625079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720