Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625080_at:

>probe:Drosophila_2:1625080_at:725:153; Interrogation_Position=2372; Antisense; ACAGGTGGCGGCAGTTTGTGACACA
>probe:Drosophila_2:1625080_at:177:693; Interrogation_Position=2386; Antisense; TTTGTGACACAATAGTGCCGCCCGG
>probe:Drosophila_2:1625080_at:526:373; Interrogation_Position=2527; Antisense; GAAGCAAACCAATCAAGTGACCCGA
>probe:Drosophila_2:1625080_at:315:221; Interrogation_Position=2541; Antisense; AAGTGACCCGAACGATCGACGACAC
>probe:Drosophila_2:1625080_at:134:637; Interrogation_Position=2556; Antisense; TCGACGACACACAGGCTCTTATTAT
>probe:Drosophila_2:1625080_at:174:361; Interrogation_Position=2584; Antisense; GAATTTCGAGTTATGGATCCAGCGG
>probe:Drosophila_2:1625080_at:205:547; Interrogation_Position=2598; Antisense; GGATCCAGCGGCATAATATATTTGT
>probe:Drosophila_2:1625080_at:326:603; Interrogation_Position=2636; Antisense; TGTTACAATTCTCACGACGTCCTGG
>probe:Drosophila_2:1625080_at:90:129; Interrogation_Position=2688; Antisense; ACCACCGTGTGCTTGGCGATGATAA
>probe:Drosophila_2:1625080_at:366:455; Interrogation_Position=2708; Antisense; GATAAGCGCTCTACGATTCGATTAA
>probe:Drosophila_2:1625080_at:535:377; Interrogation_Position=2788; Antisense; GAACCGGCCATGTGTTAGGCTTTGT
>probe:Drosophila_2:1625080_at:48:491; Interrogation_Position=2813; Antisense; GTAAATGGCTGGTTCCAACGCCTTG
>probe:Drosophila_2:1625080_at:333:201; Interrogation_Position=2829; Antisense; AACGCCTTGCGCTGAGCAAAAAGCA
>probe:Drosophila_2:1625080_at:125:657; Interrogation_Position=2877; Antisense; TAATGGCACGCCAGCATACATACAT

Paste this into a BLAST search page for me
ACAGGTGGCGGCAGTTTGTGACACATTTGTGACACAATAGTGCCGCCCGGGAAGCAAACCAATCAAGTGACCCGAAAGTGACCCGAACGATCGACGACACTCGACGACACACAGGCTCTTATTATGAATTTCGAGTTATGGATCCAGCGGGGATCCAGCGGCATAATATATTTGTTGTTACAATTCTCACGACGTCCTGGACCACCGTGTGCTTGGCGATGATAAGATAAGCGCTCTACGATTCGATTAAGAACCGGCCATGTGTTAGGCTTTGTGTAAATGGCTGGTTCCAACGCCTTGAACGCCTTGCGCTGAGCAAAAAGCATAATGGCACGCCAGCATACATACAT

Full Affymetrix probeset data:

Annotations for 1625080_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime