FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625081_at:

>probe:Drosophila_2:1625081_at:464:209; Interrogation_Position=1024; Antisense; AAGAAATACCTATCGGAGCCTCCGT
>probe:Drosophila_2:1625081_at:174:413; Interrogation_Position=1039; Antisense; GAGCCTCCGTTTCCAAAGGGTGGCA
>probe:Drosophila_2:1625081_at:507:79; Interrogation_Position=1055; Antisense; AGGGTGGCAAATTATGTCCCGCCGC
>probe:Drosophila_2:1625081_at:579:181; Interrogation_Position=1150; Antisense; AAAACTCCGGAGGACACTGTGTGCG
>probe:Drosophila_2:1625081_at:212:287; Interrogation_Position=1166; Antisense; CTGTGTGCGGCATCAAGCTGGCTCA
>probe:Drosophila_2:1625081_at:18:435; Interrogation_Position=1267; Antisense; GAGGTGGTCGACTTTCTGCAATAAC
>probe:Drosophila_2:1625081_at:305:439; Interrogation_Position=814; Antisense; GAGGCTCTAGCCAATTTTCGGCCTG
>probe:Drosophila_2:1625081_at:335:695; Interrogation_Position=829; Antisense; TTTCGGCCTGTTAGGAGTCTGCAAC
>probe:Drosophila_2:1625081_at:561:135; Interrogation_Position=852; Antisense; ACGCTCGCTGAAATTCTGCCTGGAA
>probe:Drosophila_2:1625081_at:704:131; Interrogation_Position=895; Antisense; ACCGAGCGTTGTCCCATATGTGATA
>probe:Drosophila_2:1625081_at:480:491; Interrogation_Position=914; Antisense; GTGATAGTACCGTGCTACCCGAATA
>probe:Drosophila_2:1625081_at:364:611; Interrogation_Position=960; Antisense; TGACAATGCCGACTTCTTCATCGAG
>probe:Drosophila_2:1625081_at:710:711; Interrogation_Position=976; Antisense; TTCATCGAGCGCGTCTACTGTGGTC
>probe:Drosophila_2:1625081_at:422:669; Interrogation_Position=991; Antisense; TACTGTGGTCATCTCTTTCACCAAG

Paste this into a BLAST search page for me
AAGAAATACCTATCGGAGCCTCCGTGAGCCTCCGTTTCCAAAGGGTGGCAAGGGTGGCAAATTATGTCCCGCCGCAAAACTCCGGAGGACACTGTGTGCGCTGTGTGCGGCATCAAGCTGGCTCAGAGGTGGTCGACTTTCTGCAATAACGAGGCTCTAGCCAATTTTCGGCCTGTTTCGGCCTGTTAGGAGTCTGCAACACGCTCGCTGAAATTCTGCCTGGAAACCGAGCGTTGTCCCATATGTGATAGTGATAGTACCGTGCTACCCGAATATGACAATGCCGACTTCTTCATCGAGTTCATCGAGCGCGTCTACTGTGGTCTACTGTGGTCATCTCTTTCACCAAG

Full Affymetrix probeset data:

Annotations for 1625081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720