Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625083_at:

>probe:Drosophila_2:1625083_at:647:567; Interrogation_Position=1009; Antisense; GGCAGTGATTCCATGGATTCCGAAG
>probe:Drosophila_2:1625083_at:528:221; Interrogation_Position=1031; Antisense; AAGTGGAGAGCATGCGCCGCTGTCC
>probe:Drosophila_2:1625083_at:675:719; Interrogation_Position=1093; Antisense; TTCCCGGAGATGACGAAACCCTTCG
>probe:Drosophila_2:1625083_at:297:189; Interrogation_Position=1109; Antisense; AACCCTTCGGTGTGAATCGCGGACT
>probe:Drosophila_2:1625083_at:471:31; Interrogation_Position=1142; Antisense; ATAAAATTCTCCACTGCTACCAGAT
>probe:Drosophila_2:1625083_at:278:453; Interrogation_Position=1174; Antisense; GATCTATTCATGTTTGTCACGTGGA
>probe:Drosophila_2:1625083_at:350:621; Interrogation_Position=1204; Antisense; TGCTCGTCCATCGATGCAGTGCATA
>probe:Drosophila_2:1625083_at:54:103; Interrogation_Position=1277; Antisense; AGAGCTTGAGGATCATTGTGCCCAA
>probe:Drosophila_2:1625083_at:360:661; Interrogation_Position=1303; Antisense; TAAAGATGCCTAGTACCGGGTTTGT
>probe:Drosophila_2:1625083_at:45:405; Interrogation_Position=1374; Antisense; GACTCCAAGTTCAAGGTCATCGCAT
>probe:Drosophila_2:1625083_at:442:497; Interrogation_Position=1389; Antisense; GTCATCGCATCTAAGCTGGGTAAAC
>probe:Drosophila_2:1625083_at:547:193; Interrogation_Position=1411; Antisense; AACTCCAGCTGACCCATCAAATTGA
>probe:Drosophila_2:1625083_at:6:279; Interrogation_Position=1471; Antisense; CTATGTTTTATGTTTTCTCCGTACA
>probe:Drosophila_2:1625083_at:609:603; Interrogation_Position=1533; Antisense; TGATATACTAACCTTTTTCCCCAAT

Paste this into a BLAST search page for me
GGCAGTGATTCCATGGATTCCGAAGAAGTGGAGAGCATGCGCCGCTGTCCTTCCCGGAGATGACGAAACCCTTCGAACCCTTCGGTGTGAATCGCGGACTATAAAATTCTCCACTGCTACCAGATGATCTATTCATGTTTGTCACGTGGATGCTCGTCCATCGATGCAGTGCATAAGAGCTTGAGGATCATTGTGCCCAATAAAGATGCCTAGTACCGGGTTTGTGACTCCAAGTTCAAGGTCATCGCATGTCATCGCATCTAAGCTGGGTAAACAACTCCAGCTGACCCATCAAATTGACTATGTTTTATGTTTTCTCCGTACATGATATACTAACCTTTTTCCCCAAT

Full Affymetrix probeset data:

Annotations for 1625083_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime