FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625088_at:

>probe:Drosophila_2:1625088_at:278:97; Interrogation_Position=119; Antisense; AGATAATGCGCGATCGTGCCAAGAC
>probe:Drosophila_2:1625088_at:631:55; Interrogation_Position=13; Antisense; ATGAGCCTTGAACAACAGCCAGCCG
>probe:Drosophila_2:1625088_at:58:507; Interrogation_Position=134; Antisense; GTGCCAAGACGGAGTTCTGCTCAAA
>probe:Drosophila_2:1625088_at:299:581; Interrogation_Position=164; Antisense; TGGCCGACTTCCAGGAGTGCTGCAA
>probe:Drosophila_2:1625088_at:176:115; Interrogation_Position=193; Antisense; AGCAGTATACTGATGGTGGCCACCT
>probe:Drosophila_2:1625088_at:442:193; Interrogation_Position=229; Antisense; AACTCAGCCCTGAAGGAATGCCTCA
>probe:Drosophila_2:1625088_at:583:233; Interrogation_Position=245; Antisense; AATGCCTCACCCAGTGGTATCAGAA
>probe:Drosophila_2:1625088_at:451:95; Interrogation_Position=296; Antisense; AGATATATCTGCAGGAGCGCGCCGA
>probe:Drosophila_2:1625088_at:699:583; Interrogation_Position=333; Antisense; TGGCATACCCAAGAAGCACCGGCTG
>probe:Drosophila_2:1625088_at:701:481; Interrogation_Position=366; Antisense; GTAGAGTCCCTGAGTAGTTCCTTAT
>probe:Drosophila_2:1625088_at:670:469; Interrogation_Position=382; Antisense; GTTCCTTATTGTTGTTTGCTTTGTA
>probe:Drosophila_2:1625088_at:261:177; Interrogation_Position=424; Antisense; AAACGCCGCACAATAGTCTCTGTTA
>probe:Drosophila_2:1625088_at:661:279; Interrogation_Position=441; Antisense; CTCTGTTACTGTGGCTTCCTGCAAA
>probe:Drosophila_2:1625088_at:193:323; Interrogation_Position=99; Antisense; GCGCGAAGTGCTGATACCCAAGATA

Paste this into a BLAST search page for me
AGATAATGCGCGATCGTGCCAAGACATGAGCCTTGAACAACAGCCAGCCGGTGCCAAGACGGAGTTCTGCTCAAATGGCCGACTTCCAGGAGTGCTGCAAAGCAGTATACTGATGGTGGCCACCTAACTCAGCCCTGAAGGAATGCCTCAAATGCCTCACCCAGTGGTATCAGAAAGATATATCTGCAGGAGCGCGCCGATGGCATACCCAAGAAGCACCGGCTGGTAGAGTCCCTGAGTAGTTCCTTATGTTCCTTATTGTTGTTTGCTTTGTAAAACGCCGCACAATAGTCTCTGTTACTCTGTTACTGTGGCTTCCTGCAAAGCGCGAAGTGCTGATACCCAAGATA

Full Affymetrix probeset data:

Annotations for 1625088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720