FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625089_at:

>probe:Drosophila_2:1625089_at:379:603; Interrogation_Position=1035; Antisense; TGATAGCCAGAGTTACCACCAAAAG
>probe:Drosophila_2:1625089_at:458:417; Interrogation_Position=1093; Antisense; GAGCTGCGAGTGTTTCCTTTGGGCC
>probe:Drosophila_2:1625089_at:479:285; Interrogation_Position=1144; Antisense; CTGTTCTTTCTCTCGGCAATGGTGA
>probe:Drosophila_2:1625089_at:508:61; Interrogation_Position=1162; Antisense; ATGGTGACCTATCTAGTCTTTCTAG
>probe:Drosophila_2:1625089_at:481:37; Interrogation_Position=620; Antisense; ATCTTAGCATTGGTGTCCTTTACAG
>probe:Drosophila_2:1625089_at:64:651; Interrogation_Position=708; Antisense; TAATTCGTTCCGCAATAATCCGCAA
>probe:Drosophila_2:1625089_at:725:399; Interrogation_Position=740; Antisense; GACAGGCCATCTCGAATTTGGACAA
>probe:Drosophila_2:1625089_at:579:453; Interrogation_Position=786; Antisense; GATACACCAGGTGTCACGCAGTTTC
>probe:Drosophila_2:1625089_at:694:349; Interrogation_Position=803; Antisense; GCAGTTTCCAGCAACTTTTCGATCT
>probe:Drosophila_2:1625089_at:305:699; Interrogation_Position=818; Antisense; TTTTCGATCTACCACTTTTTCTCAG
>probe:Drosophila_2:1625089_at:399:715; Interrogation_Position=836; Antisense; TTCTCAGCCTTGCACAAAGTCTTTT
>probe:Drosophila_2:1625089_at:31:581; Interrogation_Position=860; Antisense; TGGCCATGTCTATGGTTTCCTACCA
>probe:Drosophila_2:1625089_at:658:61; Interrogation_Position=947; Antisense; ATGTGGTATTGCTGACCATGTCCGT
>probe:Drosophila_2:1625089_at:647:269; Interrogation_Position=963; Antisense; CATGTCCGTGCATTCAGCTGTTAAT

Paste this into a BLAST search page for me
TGATAGCCAGAGTTACCACCAAAAGGAGCTGCGAGTGTTTCCTTTGGGCCCTGTTCTTTCTCTCGGCAATGGTGAATGGTGACCTATCTAGTCTTTCTAGATCTTAGCATTGGTGTCCTTTACAGTAATTCGTTCCGCAATAATCCGCAAGACAGGCCATCTCGAATTTGGACAAGATACACCAGGTGTCACGCAGTTTCGCAGTTTCCAGCAACTTTTCGATCTTTTTCGATCTACCACTTTTTCTCAGTTCTCAGCCTTGCACAAAGTCTTTTTGGCCATGTCTATGGTTTCCTACCAATGTGGTATTGCTGACCATGTCCGTCATGTCCGTGCATTCAGCTGTTAAT

Full Affymetrix probeset data:

Annotations for 1625089_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720