FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625091_at:

>probe:Drosophila_2:1625091_at:635:173; Interrogation_Position=309; Antisense; AAAGCGGTCTTATACCAGCTGGCTA
>probe:Drosophila_2:1625091_at:379:263; Interrogation_Position=324; Antisense; CAGCTGGCTAGCACCTCAATGGGTT
>probe:Drosophila_2:1625091_at:197:587; Interrogation_Position=358; Antisense; TGGACTTGGCTTTTGGTGATCTCTC
>probe:Drosophila_2:1625091_at:638:513; Interrogation_Position=373; Antisense; GTGATCTCTCCACCAATTTTTGGCT
>probe:Drosophila_2:1625091_at:389:277; Interrogation_Position=416; Antisense; CTTTCGGGAGGCTAACGTGTACCAT
>probe:Drosophila_2:1625091_at:216:147; Interrogation_Position=483; Antisense; ACTAACTCCATTCTCAATCTTTTGC
>probe:Drosophila_2:1625091_at:312:237; Interrogation_Position=498; Antisense; AATCTTTTGCTTCTGCGCGAATGGT
>probe:Drosophila_2:1625091_at:431:591; Interrogation_Position=519; Antisense; TGGTCAGAGTTACCTCCAATGCCAT
>probe:Drosophila_2:1625091_at:454:47; Interrogation_Position=537; Antisense; ATGCCATTTTGGTTACATCCGACCT
>probe:Drosophila_2:1625091_at:160:113; Interrogation_Position=570; Antisense; AGCACATCCGCCGAATTTGTTTTAA
>probe:Drosophila_2:1625091_at:67:3; Interrogation_Position=596; Antisense; AACGGCCGTGGATCTAAAGGACTTG
>probe:Drosophila_2:1625091_at:582:727; Interrogation_Position=618; Antisense; TTGGATATTCTTGGGCGCAACGCTT
>probe:Drosophila_2:1625091_at:587:411; Interrogation_Position=647; Antisense; GACCGCCCTTATTCTGGACTTAATT
>probe:Drosophila_2:1625091_at:534:169; Interrogation_Position=766; Antisense; AAAGTAGTAGTCCACTTCCGCTGAA

Paste this into a BLAST search page for me
AAAGCGGTCTTATACCAGCTGGCTACAGCTGGCTAGCACCTCAATGGGTTTGGACTTGGCTTTTGGTGATCTCTCGTGATCTCTCCACCAATTTTTGGCTCTTTCGGGAGGCTAACGTGTACCATACTAACTCCATTCTCAATCTTTTGCAATCTTTTGCTTCTGCGCGAATGGTTGGTCAGAGTTACCTCCAATGCCATATGCCATTTTGGTTACATCCGACCTAGCACATCCGCCGAATTTGTTTTAAAACGGCCGTGGATCTAAAGGACTTGTTGGATATTCTTGGGCGCAACGCTTGACCGCCCTTATTCTGGACTTAATTAAAGTAGTAGTCCACTTCCGCTGAA

Full Affymetrix probeset data:

Annotations for 1625091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720