FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625092_at:

>probe:Drosophila_2:1625092_at:248:463; Interrogation_Position=1026; Antisense; GATTCCCGGTGTTGGCTTATATCGA
>probe:Drosophila_2:1625092_at:153:189; Interrogation_Position=1060; Antisense; AACACCTATGACTGGTCTGCTATGA
>probe:Drosophila_2:1625092_at:208:459; Interrogation_Position=1083; Antisense; GATATACCTATATGGACCGATGCTG
>probe:Drosophila_2:1625092_at:198:555; Interrogation_Position=1096; Antisense; GGACCGATGCTGATCTTGAGTTTAT
>probe:Drosophila_2:1625092_at:717:517; Interrogation_Position=1126; Antisense; GTGGTCACGTTTATCCTGACAGTAA
>probe:Drosophila_2:1625092_at:345:711; Interrogation_Position=1178; Antisense; TTAAGAGTTCTACCCAACAGCAGCG
>probe:Drosophila_2:1625092_at:289:461; Interrogation_Position=1222; Antisense; GATTTTCTATTATACCTACGACTGT
>probe:Drosophila_2:1625092_at:586:31; Interrogation_Position=1282; Antisense; ATAACTTACTTCGTCAAGCGGCACA
>probe:Drosophila_2:1625092_at:426:325; Interrogation_Position=1314; Antisense; GCGACAAGTCCTTCGGGTGCCAAAT
>probe:Drosophila_2:1625092_at:64:625; Interrogation_Position=1343; Antisense; TCCATTTGGGTTCCGGTATAGTCGT
>probe:Drosophila_2:1625092_at:19:437; Interrogation_Position=1431; Antisense; GAGGAGACAACAACCTGCATCTTGA
>probe:Drosophila_2:1625092_at:177:383; Interrogation_Position=907; Antisense; GAACGTAGCTATCACTTTCTCATCT
>probe:Drosophila_2:1625092_at:546:277; Interrogation_Position=921; Antisense; CTTTCTCATCTACAACATCTACGGT
>probe:Drosophila_2:1625092_at:532:357; Interrogation_Position=950; Antisense; GCACACCTGCTATCATGACGGCAAT

Paste this into a BLAST search page for me
GATTCCCGGTGTTGGCTTATATCGAAACACCTATGACTGGTCTGCTATGAGATATACCTATATGGACCGATGCTGGGACCGATGCTGATCTTGAGTTTATGTGGTCACGTTTATCCTGACAGTAATTAAGAGTTCTACCCAACAGCAGCGGATTTTCTATTATACCTACGACTGTATAACTTACTTCGTCAAGCGGCACAGCGACAAGTCCTTCGGGTGCCAAATTCCATTTGGGTTCCGGTATAGTCGTGAGGAGACAACAACCTGCATCTTGAGAACGTAGCTATCACTTTCTCATCTCTTTCTCATCTACAACATCTACGGTGCACACCTGCTATCATGACGGCAAT

Full Affymetrix probeset data:

Annotations for 1625092_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720