Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625095_at:

>probe:Drosophila_2:1625095_at:704:333; Interrogation_Position=1540; Antisense; GCTGTGGATGCTGTGGCTTATCAAA
>probe:Drosophila_2:1625095_at:459:437; Interrogation_Position=1573; Antisense; GAGGAGACCTACAGGCAGATCACCT
>probe:Drosophila_2:1625095_at:15:393; Interrogation_Position=1628; Antisense; GAAATCTTAATCTCTACCAGGCCGA
>probe:Drosophila_2:1625095_at:691:543; Interrogation_Position=1673; Antisense; GGATCAAGTCTGGAAACCCTGGCTA
>probe:Drosophila_2:1625095_at:673:583; Interrogation_Position=1692; Antisense; TGGCTACTTTGTCATCTTCAATCCC
>probe:Drosophila_2:1625095_at:647:421; Interrogation_Position=1734; Antisense; GAGCAACTTTACTATCCCAGACAAT
>probe:Drosophila_2:1625095_at:32:409; Interrogation_Position=1773; Antisense; GACGGTGTCCTATTTCAGCGAGCAG
>probe:Drosophila_2:1625095_at:293:145; Interrogation_Position=1817; Antisense; ACTCCGGAAAGGTTGCTCATGCTGG
>probe:Drosophila_2:1625095_at:155:271; Interrogation_Position=1834; Antisense; CATGCTGGACGCGTGAATCTCAAGG
>probe:Drosophila_2:1625095_at:585:651; Interrogation_Position=1853; Antisense; TCAAGGATCTCAAGGTGGCCCCGCA
>probe:Drosophila_2:1625095_at:402:627; Interrogation_Position=1879; Antisense; TCCAGCATTATCCTGACCTATGTGC
>probe:Drosophila_2:1625095_at:208:493; Interrogation_Position=1997; Antisense; GTAACTCGCTTTGTTAACCGTTGAG
>probe:Drosophila_2:1625095_at:150:385; Interrogation_Position=2062; Antisense; GAACTTTTTAGACTTGCTTGCTTGT
>probe:Drosophila_2:1625095_at:494:343; Interrogation_Position=2077; Antisense; GCTTGCTTGTTAAATGCGCTTGCTA

Paste this into a BLAST search page for me
GCTGTGGATGCTGTGGCTTATCAAAGAGGAGACCTACAGGCAGATCACCTGAAATCTTAATCTCTACCAGGCCGAGGATCAAGTCTGGAAACCCTGGCTATGGCTACTTTGTCATCTTCAATCCCGAGCAACTTTACTATCCCAGACAATGACGGTGTCCTATTTCAGCGAGCAGACTCCGGAAAGGTTGCTCATGCTGGCATGCTGGACGCGTGAATCTCAAGGTCAAGGATCTCAAGGTGGCCCCGCATCCAGCATTATCCTGACCTATGTGCGTAACTCGCTTTGTTAACCGTTGAGGAACTTTTTAGACTTGCTTGCTTGTGCTTGCTTGTTAAATGCGCTTGCTA

Full Affymetrix probeset data:

Annotations for 1625095_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime