FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625096_at:

>probe:Drosophila_2:1625096_at:591:231; Interrogation_Position=1592; Antisense; AATGCAAGCCTCGTCATGCTATTAA
>probe:Drosophila_2:1625096_at:451:227; Interrogation_Position=1615; Antisense; AATGGCGATTCCAACGCTGTACCAA
>probe:Drosophila_2:1625096_at:248:673; Interrogation_Position=1682; Antisense; TAGCCTGCAGATTTGATGCCACCGG
>probe:Drosophila_2:1625096_at:50:77; Interrogation_Position=1712; Antisense; AGGAGCATCTGCGTTACCGACTGGA
>probe:Drosophila_2:1625096_at:45:113; Interrogation_Position=1751; Antisense; AGCACTTGATGAGCCACCTGTTCGA
>probe:Drosophila_2:1625096_at:665:537; Interrogation_Position=1779; Antisense; GGTCAATGACCCCAATGTCCAGTTG
>probe:Drosophila_2:1625096_at:628:727; Interrogation_Position=1801; Antisense; TTGGAGGAACGACCCAGCCTGAATT
>probe:Drosophila_2:1625096_at:522:5; Interrogation_Position=1823; Antisense; ATTGCTCGCCAATTCAAACGGAAGT
>probe:Drosophila_2:1625096_at:101:563; Interrogation_Position=1842; Antisense; GGAAGTACAGGCCATCCAGTGGTTT
>probe:Drosophila_2:1625096_at:378:83; Interrogation_Position=1859; Antisense; AGTGGTTTGGCTGCATCTTGACCTC
>probe:Drosophila_2:1625096_at:499:273; Interrogation_Position=1885; Antisense; CATTTCACCCTGCTGATTATTTCCA
>probe:Drosophila_2:1625096_at:369:7; Interrogation_Position=1920; Antisense; ATTGCTCGAGACTCTCTCCGAATGG
>probe:Drosophila_2:1625096_at:66:639; Interrogation_Position=1979; Antisense; TCGATTTAGCCAATTTGCTGCCGCT
>probe:Drosophila_2:1625096_at:516:621; Interrogation_Position=1994; Antisense; TGCTGCCGCTGCTCACAAATATTGT

Paste this into a BLAST search page for me
AATGCAAGCCTCGTCATGCTATTAAAATGGCGATTCCAACGCTGTACCAATAGCCTGCAGATTTGATGCCACCGGAGGAGCATCTGCGTTACCGACTGGAAGCACTTGATGAGCCACCTGTTCGAGGTCAATGACCCCAATGTCCAGTTGTTGGAGGAACGACCCAGCCTGAATTATTGCTCGCCAATTCAAACGGAAGTGGAAGTACAGGCCATCCAGTGGTTTAGTGGTTTGGCTGCATCTTGACCTCCATTTCACCCTGCTGATTATTTCCAATTGCTCGAGACTCTCTCCGAATGGTCGATTTAGCCAATTTGCTGCCGCTTGCTGCCGCTGCTCACAAATATTGT

Full Affymetrix probeset data:

Annotations for 1625096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720