FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625099_at:

>probe:Drosophila_2:1625099_at:74:725; Interrogation_Position=1119; Antisense; TTGAGCTGCGGGTGCTGGACAAACT
>probe:Drosophila_2:1625099_at:540:37; Interrogation_Position=1178; Antisense; ATCTACGCCCGTTTGCGGTTCAAGT
>probe:Drosophila_2:1625099_at:529:471; Interrogation_Position=1195; Antisense; GTTCAAGTGGGCAGGCTACTACCGA
>probe:Drosophila_2:1625099_at:681:117; Interrogation_Position=1247; Antisense; AGCTCCGACGGCATGTGGTTTCGCA
>probe:Drosophila_2:1625099_at:392:317; Interrogation_Position=1269; Antisense; GCACGGGAGACATCGGTTACCTTGA
>probe:Drosophila_2:1625099_at:592:539; Interrogation_Position=1302; Antisense; GGTATCTGTACATCCAGACCCGTGA
>probe:Drosophila_2:1625099_at:483:191; Interrogation_Position=1349; Antisense; AACTTCCAGATCTATCCCGAGCAGA
>probe:Drosophila_2:1625099_at:232:77; Interrogation_Position=1377; Antisense; AGGAGTTCATCCTCAGATTGCCCGG
>probe:Drosophila_2:1625099_at:64:85; Interrogation_Position=1406; Antisense; AGTGAGGCCTGTGTCTTCGGCATAC
>probe:Drosophila_2:1625099_at:709:327; Interrogation_Position=1436; Antisense; GCGGTGAGCACCAATCTTACGGCCT
>probe:Drosophila_2:1625099_at:352:521; Interrogation_Position=1526; Antisense; GTGGAACACCACTTGAGCGGAGCCT
>probe:Drosophila_2:1625099_at:384:121; Interrogation_Position=1541; Antisense; AGCGGAGCCTACCACATTCGAGGAG
>probe:Drosophila_2:1625099_at:469:517; Interrogation_Position=1566; Antisense; GTGTGTATTTCATCGACAGTCTGCC
>probe:Drosophila_2:1625099_at:328:399; Interrogation_Position=1580; Antisense; GACAGTCTGCCAAAAACACCCAATG

Paste this into a BLAST search page for me
TTGAGCTGCGGGTGCTGGACAAACTATCTACGCCCGTTTGCGGTTCAAGTGTTCAAGTGGGCAGGCTACTACCGAAGCTCCGACGGCATGTGGTTTCGCAGCACGGGAGACATCGGTTACCTTGAGGTATCTGTACATCCAGACCCGTGAAACTTCCAGATCTATCCCGAGCAGAAGGAGTTCATCCTCAGATTGCCCGGAGTGAGGCCTGTGTCTTCGGCATACGCGGTGAGCACCAATCTTACGGCCTGTGGAACACCACTTGAGCGGAGCCTAGCGGAGCCTACCACATTCGAGGAGGTGTGTATTTCATCGACAGTCTGCCGACAGTCTGCCAAAAACACCCAATG

Full Affymetrix probeset data:

Annotations for 1625099_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720