FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625101_at:

>probe:Drosophila_2:1625101_at:555:169; Interrogation_Position=104; Antisense; AAAGGTCGTTCAATGGCACCCAGGG
>probe:Drosophila_2:1625101_at:470:621; Interrogation_Position=14; Antisense; TGCTGCACTTAAGGCTATTCGATAG
>probe:Drosophila_2:1625101_at:480:201; Interrogation_Position=168; Antisense; AACCGACGTGGCTGCAGTTAATCTG
>probe:Drosophila_2:1625101_at:360:655; Interrogation_Position=186; Antisense; TAATCTGACATATTTCACACCTGCG
>probe:Drosophila_2:1625101_at:147:689; Interrogation_Position=196; Antisense; TATTTCACACCTGCGATATCACACG
>probe:Drosophila_2:1625101_at:280:23; Interrogation_Position=211; Antisense; ATATCACACGTGATGCTGGCGCCAA
>probe:Drosophila_2:1625101_at:492:605; Interrogation_Position=221; Antisense; TGATGCTGGCGCCAACAACGATAGC
>probe:Drosophila_2:1625101_at:122:199; Interrogation_Position=237; Antisense; AACGATAGCAACCACGACAGCCTCG
>probe:Drosophila_2:1625101_at:648:155; Interrogation_Position=253; Antisense; ACAGCCTCGGCCACAATGGTCCAGA
>probe:Drosophila_2:1625101_at:383:63; Interrogation_Position=268; Antisense; ATGGTCCAGATCCAGACGACAGCGG
>probe:Drosophila_2:1625101_at:75:399; Interrogation_Position=285; Antisense; GACAGCGGCGCCAAGTCACGACTTG
>probe:Drosophila_2:1625101_at:9:691; Interrogation_Position=29; Antisense; TATTCGATAGCTCACTCTACTACAC
>probe:Drosophila_2:1625101_at:11:327; Interrogation_Position=335; Antisense; GCGACCCCGGCGAATTTGACAATTT
>probe:Drosophila_2:1625101_at:128:247; Interrogation_Position=361; Antisense; AATTCGTTCTACTTTTATGAGGTGG

Paste this into a BLAST search page for me
AAAGGTCGTTCAATGGCACCCAGGGTGCTGCACTTAAGGCTATTCGATAGAACCGACGTGGCTGCAGTTAATCTGTAATCTGACATATTTCACACCTGCGTATTTCACACCTGCGATATCACACGATATCACACGTGATGCTGGCGCCAATGATGCTGGCGCCAACAACGATAGCAACGATAGCAACCACGACAGCCTCGACAGCCTCGGCCACAATGGTCCAGAATGGTCCAGATCCAGACGACAGCGGGACAGCGGCGCCAAGTCACGACTTGTATTCGATAGCTCACTCTACTACACGCGACCCCGGCGAATTTGACAATTTAATTCGTTCTACTTTTATGAGGTGG

Full Affymetrix probeset data:

Annotations for 1625101_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720