FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625102_at:

>probe:Drosophila_2:1625102_at:175:529; Interrogation_Position=6759; Antisense; GGTGACCTTTTTGCAGGACCTATCC
>probe:Drosophila_2:1625102_at:436:555; Interrogation_Position=6774; Antisense; GGACCTATCCCAGTTACTCGAGAAT
>probe:Drosophila_2:1625102_at:83:365; Interrogation_Position=6795; Antisense; GAATTTGAAAACCAGCCCACAGACG
>probe:Drosophila_2:1625102_at:411:561; Interrogation_Position=6819; Antisense; GGAACCGCGAATGGCCCTAGTTTGG
>probe:Drosophila_2:1625102_at:413:173; Interrogation_Position=6897; Antisense; AAAGCCACTTCACATGCTGGCGAGG
>probe:Drosophila_2:1625102_at:117:583; Interrogation_Position=6914; Antisense; TGGCGAGGCACCTGCAGATTGCATC
>probe:Drosophila_2:1625102_at:547:657; Interrogation_Position=7022; Antisense; TAACTCGTTGCTTGGCTTGTGTGAT
>probe:Drosophila_2:1625102_at:175:605; Interrogation_Position=7043; Antisense; TGATCTTTTCGCTGTTTCCGGCCAA
>probe:Drosophila_2:1625102_at:701:525; Interrogation_Position=7070; Antisense; GGGACCTTCGCATACCGTCAGAAGA
>probe:Drosophila_2:1625102_at:674:527; Interrogation_Position=7112; Antisense; GGGAGCTGTCTATGCTGCTGGCCAA
>probe:Drosophila_2:1625102_at:2:211; Interrogation_Position=7138; Antisense; AAGAAGTTCACCGACATCAAGCCCT
>probe:Drosophila_2:1625102_at:90:475; Interrogation_Position=7177; Antisense; GTTAGCCTGCTCAAGGAATCCACAT
>probe:Drosophila_2:1625102_at:285:25; Interrogation_Position=7226; Antisense; ATATGGTCTGCCGACTCATCAGCAT
>probe:Drosophila_2:1625102_at:98:425; Interrogation_Position=7261; Antisense; GAGAGCTACCTGACAACCATTCCAG

Paste this into a BLAST search page for me
GGTGACCTTTTTGCAGGACCTATCCGGACCTATCCCAGTTACTCGAGAATGAATTTGAAAACCAGCCCACAGACGGGAACCGCGAATGGCCCTAGTTTGGAAAGCCACTTCACATGCTGGCGAGGTGGCGAGGCACCTGCAGATTGCATCTAACTCGTTGCTTGGCTTGTGTGATTGATCTTTTCGCTGTTTCCGGCCAAGGGACCTTCGCATACCGTCAGAAGAGGGAGCTGTCTATGCTGCTGGCCAAAAGAAGTTCACCGACATCAAGCCCTGTTAGCCTGCTCAAGGAATCCACATATATGGTCTGCCGACTCATCAGCATGAGAGCTACCTGACAACCATTCCAG

Full Affymetrix probeset data:

Annotations for 1625102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720