FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625104_at:

>probe:Drosophila_2:1625104_at:45:571; Interrogation_Position=1406; Antisense; GGCTTCCTTCATGAACAGAACCGTA
>probe:Drosophila_2:1625104_at:105:539; Interrogation_Position=1442; Antisense; GGTTATGTGGCCATCCAGTACAACA
>probe:Drosophila_2:1625104_at:333:89; Interrogation_Position=1458; Antisense; AGTACAACAATGTCCAGTCCTCGGC
>probe:Drosophila_2:1625104_at:720:61; Interrogation_Position=1473; Antisense; AGTCCTCGGCGATGAACAACTTCGA
>probe:Drosophila_2:1625104_at:607:611; Interrogation_Position=1485; Antisense; TGAACAACTTCGAAAAGGCCGCCCG
>probe:Drosophila_2:1625104_at:441:67; Interrogation_Position=1539; Antisense; ATGGCAGCGTGATGCACTACTCCAA
>probe:Drosophila_2:1625104_at:514:99; Interrogation_Position=1635; Antisense; AGAGGAATGGTTTCTCCGACTACGA
>probe:Drosophila_2:1625104_at:282:489; Interrogation_Position=1681; Antisense; GTACGATTGTGGCACCGTCAACGCT
>probe:Drosophila_2:1625104_at:199:201; Interrogation_Position=1700; Antisense; AACGCTGTTCCAGTTGCCCCAGGAT
>probe:Drosophila_2:1625104_at:453:5; Interrogation_Position=1775; Antisense; ATTGTAGATAGCTTCATCGGCGGCC
>probe:Drosophila_2:1625104_at:113:647; Interrogation_Position=1788; Antisense; TCATCGGCGGCCTGATCAGCGGATT
>probe:Drosophila_2:1625104_at:518:399; Interrogation_Position=1849; Antisense; GACAGAATCTACTAGCTCGTACCAT
>probe:Drosophila_2:1625104_at:537:265; Interrogation_Position=1871; Antisense; CATCCACCAACGCTCGAAAGTATTT
>probe:Drosophila_2:1625104_at:157:393; Interrogation_Position=1886; Antisense; GAAAGTATTTAACGCATTCCACATA

Paste this into a BLAST search page for me
GGCTTCCTTCATGAACAGAACCGTAGGTTATGTGGCCATCCAGTACAACAAGTACAACAATGTCCAGTCCTCGGCAGTCCTCGGCGATGAACAACTTCGATGAACAACTTCGAAAAGGCCGCCCGATGGCAGCGTGATGCACTACTCCAAAGAGGAATGGTTTCTCCGACTACGAGTACGATTGTGGCACCGTCAACGCTAACGCTGTTCCAGTTGCCCCAGGATATTGTAGATAGCTTCATCGGCGGCCTCATCGGCGGCCTGATCAGCGGATTGACAGAATCTACTAGCTCGTACCATCATCCACCAACGCTCGAAAGTATTTGAAAGTATTTAACGCATTCCACATA

Full Affymetrix probeset data:

Annotations for 1625104_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720