FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625107_at:

>probe:Drosophila_2:1625107_at:238:575; Interrogation_Position=1021; Antisense; GGCGTACAAAGGTCCGGACAGCTAT
>probe:Drosophila_2:1625107_at:653:277; Interrogation_Position=1042; Antisense; CTATAGTTCGGTGATAGCCTCGCAC
>probe:Drosophila_2:1625107_at:163:457; Interrogation_Position=1054; Antisense; GATAGCCTCGCACGAATTCGGCGAT
>probe:Drosophila_2:1625107_at:406:679; Interrogation_Position=1098; Antisense; TATGGAACGAGTGCCGATCCGCCAA
>probe:Drosophila_2:1625107_at:655:449; Interrogation_Position=1113; Antisense; GATCCGCCAATTACGCGTAGCAGCA
>probe:Drosophila_2:1625107_at:332:213; Interrogation_Position=1154; Antisense; AAGAGCGCTGCAGATTGTACATATA
>probe:Drosophila_2:1625107_at:659:19; Interrogation_Position=1176; Antisense; ATATACGAACGAGACAGCACCTAGA
>probe:Drosophila_2:1625107_at:54:265; Interrogation_Position=1190; Antisense; CAGCACCTAGACAACAGCCTTATAA
>probe:Drosophila_2:1625107_at:113:85; Interrogation_Position=1229; Antisense; AGTGGATGATACCTCAACCGTTCAG
>probe:Drosophila_2:1625107_at:438:517; Interrogation_Position=1391; Antisense; GTGTGGTCTGATACCTTTGAATGCA
>probe:Drosophila_2:1625107_at:688:321; Interrogation_Position=867; Antisense; GCGCGTTCATTCTGTCGCAGAAGGC
>probe:Drosophila_2:1625107_at:207:227; Interrogation_Position=887; Antisense; AAGGCACTGCGCCAGCTGTATGCCG
>probe:Drosophila_2:1625107_at:670:133; Interrogation_Position=942; Antisense; ACGACGTCTACCTGGGCATAGTGGC
>probe:Drosophila_2:1625107_at:69:707; Interrogation_Position=968; Antisense; TTGAAAGCGGGCATTTCCCTTCAGC

Paste this into a BLAST search page for me
GGCGTACAAAGGTCCGGACAGCTATCTATAGTTCGGTGATAGCCTCGCACGATAGCCTCGCACGAATTCGGCGATTATGGAACGAGTGCCGATCCGCCAAGATCCGCCAATTACGCGTAGCAGCAAAGAGCGCTGCAGATTGTACATATAATATACGAACGAGACAGCACCTAGACAGCACCTAGACAACAGCCTTATAAAGTGGATGATACCTCAACCGTTCAGGTGTGGTCTGATACCTTTGAATGCAGCGCGTTCATTCTGTCGCAGAAGGCAAGGCACTGCGCCAGCTGTATGCCGACGACGTCTACCTGGGCATAGTGGCTTGAAAGCGGGCATTTCCCTTCAGC

Full Affymetrix probeset data:

Annotations for 1625107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720